EMAIL THIS PAGE TO A FRIEND

OR51I2

olfactory receptor, family 51, subfamily I, member 2

Synonyms: OR11-38
UniProtKB ID: Q9H344, Q6IF81
Gene ID:
Human(390064) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Domestic Rabbit(100328868) olfactory receptor, family 51, subfamily I, member 2
cow(507078) olfactory receptor, family 51, subfamily I, member 2
dog(485269) cOR51I2 olfactory receptor family 51 subfamily I-like
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501682 Anti-OR51I2 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004754 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110188 predicted 233
2 SASI_Hs01_00110189 predicted 673
3 SASI_Hs01_00110190 predicted 609
4 SASI_Hs01_00110191 predicted 333
5 SASI_Hs02_00304705 predicted 249
6 SASI_Hs01_00110192 predicted 239
7 SASI_Hs01_00110193 predicted 707
8 SASI_Hs01_00110194 predicted 392
9 SASI_Hs01_00110195 predicted 305
10 SASI_Hs01_00110197 predicted 615
11 SASI_Hs01_00110196 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372357
OR51I2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 51, subfamily I, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-701s1c1
Sequence:CCGGGCCTCAAAGCTCTCAACACATCTCGAGATGTGTTGAGAGCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-321s1c1
Sequence:CCGGCTCCATGATGGAATCAGGTATCTCGAGATACCTGATTCCATCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-286s1c1
Sequence:CCGGGCCTGTCTAATTCAGATGTTTCTCGAGAAACATCTGAATTAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-582s1c1
Sequence:CCGGCAACAGCATCTATGGACTCTTCTCGAGAAGAGTCCATAGATGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372357
OR51I2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 51, subfamily I, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-701s1c1
Sequence:CCGGGCCTCAAAGCTCTCAACACATCTCGAGATGTGTTGAGAGCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-321s1c1
Sequence:CCGGCTCCATGATGGAATCAGGTATCTCGAGATACCTGATTCCATCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-286s1c1
Sequence:CCGGGCCTGTCTAATTCAGATGTTTCTCGAGAAACATCTGAATTAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-582s1c1
Sequence:CCGGCAACAGCATCTATGGACTCTTCTCGAGAAGAGTCCATAGATGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372357
OR51I2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 51, subfamily I, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-701s1c1
Sequence:CCGGGCCTCAAAGCTCTCAACACATCTCGAGATGTGTTGAGAGCTTTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-321s1c1
Sequence:CCGGCTCCATGATGGAATCAGGTATCTCGAGATACCTGATTCCATCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-286s1c1
Sequence:CCGGGCCTGTCTAATTCAGATGTTTCTCGAGAAACATCTGAATTAGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372357.1-582s1c1
Sequence:CCGGCAACAGCATCTATGGACTCTTCTCGAGAAGAGTCCATAGATGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks