EMAIL THIS PAGE TO A FRIEND

OR52E2

olfactory receptor, family 52, subfamily E, member 2

UniProtKB ID: Q8NGJ4
Gene ID:
Human(119678) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(491648) cOR52E13 olfactory receptor family 52 subfamily E-like
cow(616558) olfactory receptor, family 52, subfamily E, member 2
Domestic Rabbit(100328840) olfactory receptor, family 52, subfamily E, member 2
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_061610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_061610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_061610 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136871 MISSION® esiRNA esiRNA human OR52E2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005164 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039775 predicted 591
2 SASI_Hs01_00039777 predicted 414
3 SASI_Hs01_00039778 predicted 475
4 SASI_Hs01_00039779 predicted 499
5 SASI_Hs01_00039780 predicted 444
6 SASI_Hs02_00304724 predicted 594
7 SASI_Hs01_00039781 predicted 686
8 SASI_Hs01_00039783 predicted 633
9 SASI_Hs02_00304725 predicted 739
10 SASI_Hs02_00304726 predicted 430
11 SASI_Hs01_00039776 predicted 742
12 SASI_Hs01_00039782 predicted 426
13 SASI_Hs01_00039784 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_061610
OR52E2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily E, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-90s1c1
Sequence:CCGGCTTTCCCTTCTGTGCTGTGTACTCGAGTACACAGCACAGAAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-355s1c2
Sequence:CCGGGCAATGGCTTATGACAGCTATCTCGAGATAGCTGTCATAAGCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-547s1c1
Sequence:CCGGCACATGGGTCTTGCTCATCTACTCGAGTAGATGAGCAAGACCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-636s1c1
Sequence:CCGGCACAGTCATTGCCCTTTCTTACTCGAGTAAGAAAGGGCAATGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-646s1c1
Sequence:CCGGGCCCTTTCTTATGTGCATATTCTCGAGAATATGCACATAAGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_061610
OR52E2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily E, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-90s1c1
Sequence:CCGGCTTTCCCTTCTGTGCTGTGTACTCGAGTACACAGCACAGAAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-355s1c2
Sequence:CCGGGCAATGGCTTATGACAGCTATCTCGAGATAGCTGTCATAAGCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-547s1c1
Sequence:CCGGCACATGGGTCTTGCTCATCTACTCGAGTAGATGAGCAAGACCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-636s1c1
Sequence:CCGGCACAGTCATTGCCCTTTCTTACTCGAGTAAGAAAGGGCAATGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-646s1c1
Sequence:CCGGGCCCTTTCTTATGTGCATATTCTCGAGAATATGCACATAAGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_061610
OR52E2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily E, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-90s1c1
Sequence:CCGGCTTTCCCTTCTGTGCTGTGTACTCGAGTACACAGCACAGAAGGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-355s1c2
Sequence:CCGGGCAATGGCTTATGACAGCTATCTCGAGATAGCTGTCATAAGCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-547s1c1
Sequence:CCGGCACATGGGTCTTGCTCATCTACTCGAGTAGATGAGCAAGACCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-636s1c1
Sequence:CCGGCACAGTCATTGCCCTTTCTTACTCGAGTAAGAAAGGGCAATGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_061610.2-646s1c1
Sequence:CCGGGCCCTTTCTTATGTGCATATTCTCGAGAATATGCACATAAGAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks