EMAIL THIS PAGE TO A FRIEND

OR52H1

olfactory receptor, family 52, subfamily H, member 1

Synonyms: OR11-41 OR11-45
UniProtKB ID: Q8NGJ2, B9EH26, Q6IF79
Gene ID:
Human(390067) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(617787) olfactory receptor, family 52, subfamily H, member 1
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301897 ANTI-OR52H1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005289 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040981 MISSION® esiRNA esiRNA human OR52H1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005289 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045299 predicted 678
2 SASI_Hs01_00045300 predicted 317
3 SASI_Hs01_00045301 predicted 390
4 SASI_Hs01_00045302 predicted 640
5 SASI_Hs01_00045303 predicted 293
6 SASI_Hs02_00304835 predicted 326
7 SASI_Hs01_00045305 predicted 605
8 SASI_Hs01_00045307 predicted 239
9 SASI_Hs01_00045308 predicted 733
10 SASI_Hs02_00304836 predicted 618
11 SASI_Hs01_00045304 predicted 358
12 SASI_Hs01_00045306 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372360
OR52H1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily H, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000193170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-315s1c2
Sequence:CCGGCCTTACACAAATGTTCTTCCTCTCGAGAGGAAGAACATTTGTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-549s1c1
Sequence:CCGGCCACACATACTGTGAGCATATCTCGAGATATGCTCACAGTATGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-411s1c1
Sequence:CCGGCTTGAGATATACCACCATCTTCTCGAGAAGATGGTGGTATATCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372360
OR52H1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily H, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000193170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-315s1c2
Sequence:CCGGCCTTACACAAATGTTCTTCCTCTCGAGAGGAAGAACATTTGTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-549s1c1
Sequence:CCGGCCACACATACTGTGAGCATATCTCGAGATATGCTCACAGTATGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-411s1c1
Sequence:CCGGCTTGAGATATACCACCATCTTCTCGAGAAGATGGTGGTATATCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372360
OR52H1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily H, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000193170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-315s1c2
Sequence:CCGGCCTTACACAAATGTTCTTCCTCTCGAGAGGAAGAACATTTGTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-549s1c1
Sequence:CCGGCCACACATACTGTGAGCATATCTCGAGATATGCTCACAGTATGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372360.1-411s1c1
Sequence:CCGGCTTGAGATATACCACCATCTTCTCGAGAAGATGGTGGTATATCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005289
OR52H1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily H, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-486s21c1
Sequence:CCGGCATCATCCTGCCAGATGTATTCTCGAGAATACATCTGGCAGGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-29s21c1
Sequence:CCGGTCAACCTGAGCAGTTACAATCCTCGAGGATTGTAACTGCTCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-647s21c1
Sequence:CCGGTCTCAGATGTGATTCTCATTGCTCGAGCAATGAGAATCACATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-256s21c1
Sequence:CCGGGTGCCTAAAGCACTCAGTATCCTCGAGGATACTGAGTGCTTTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-364s21c1
Sequence:CCGGATTCTGATGGCCATGGCATTTCTCGAGAAATGCCATGGCCATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-402s21c1
Sequence:CCGGCTGTTCTCCCTTGAGATATACCTCGAGGTATATCTCAAGGGAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-527s21c1
Sequence:CCGGTCTGCAGGACACGCATCATACCTCGAGGTATGATGCGTGTCCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-325s21c1
Sequence:CCGGATGTTCTTCCTTCACTATAACCTCGAGGTTATAGTGAAGGAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005289
OR52H1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily H, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-486s21c1
Sequence:CCGGCATCATCCTGCCAGATGTATTCTCGAGAATACATCTGGCAGGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-29s21c1
Sequence:CCGGTCAACCTGAGCAGTTACAATCCTCGAGGATTGTAACTGCTCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-647s21c1
Sequence:CCGGTCTCAGATGTGATTCTCATTGCTCGAGCAATGAGAATCACATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-256s21c1
Sequence:CCGGGTGCCTAAAGCACTCAGTATCCTCGAGGATACTGAGTGCTTTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-364s21c1
Sequence:CCGGATTCTGATGGCCATGGCATTTCTCGAGAAATGCCATGGCCATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-402s21c1
Sequence:CCGGCTGTTCTCCCTTGAGATATACCTCGAGGTATATCTCAAGGGAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-527s21c1
Sequence:CCGGTCTGCAGGACACGCATCATACCTCGAGGTATGATGCGTGTCCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-325s21c1
Sequence:CCGGATGTTCTTCCTTCACTATAACCTCGAGGTTATAGTGAAGGAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005289
OR52H1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily H, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-486s21c1
Sequence:CCGGCATCATCCTGCCAGATGTATTCTCGAGAATACATCTGGCAGGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-29s21c1
Sequence:CCGGTCAACCTGAGCAGTTACAATCCTCGAGGATTGTAACTGCTCAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-647s21c1
Sequence:CCGGTCTCAGATGTGATTCTCATTGCTCGAGCAATGAGAATCACATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-256s21c1
Sequence:CCGGGTGCCTAAAGCACTCAGTATCCTCGAGGATACTGAGTGCTTTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-364s21c1
Sequence:CCGGATTCTGATGGCCATGGCATTTCTCGAGAAATGCCATGGCCATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-402s21c1
Sequence:CCGGCTGTTCTCCCTTGAGATATACCTCGAGGTATATCTCAAGGGAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-527s21c1
Sequence:CCGGTCTGCAGGACACGCATCATACCTCGAGGTATGATGCGTGTCCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005289.1-325s21c1
Sequence:CCGGATGTTCTTCCTTCACTATAACCTCGAGGTTATAGTGAAGGAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks