EMAIL THIS PAGE TO A FRIEND

OR52I1

olfactory receptor, family 52, subfamily I, member 1

Synonyms: OR11-13
Species: Human OR52I1(390037)
UniProtKB ID: Q8NGK6, Q6IF91
Gene ID:
Human(390037) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
6 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305909 ANTI-OR52I1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005169 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011938 predicted 452
2 SASI_Hs01_00011939 predicted 488
3 SASI_Hs01_00011940 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372348
OR52I1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily I, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-647s1c1
Sequence:CCGGCCTTCATTGCTGCCTCCTATACTCGAGTATAGGAGGCAGCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-537s1c1
Sequence:CCGGCCACTCCTACTGTAAGCACATCTCGAGATGTGCTTACAGTAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-284s1c1
Sequence:CCGGCCATCAGCTTTAGTGCTTGTTCTCGAGAACAAGCACTAAAGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-484s1c1
Sequence:CCGGCCACTGAGTTGGATGATGAATCTCGAGATTCATCATCCAACTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-495s1c1
Sequence:CCGGGATGATGAATCATCTACCTTTCTCGAGAAAGGTAGATGATTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-655s1c1
Sequence:CCGGGCTGCCTCCTATATCTTAATTCTCGAGAATTAAGATATAGGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-682s1c1
Sequence:CCGGGCAGTATTTGATCTCTCCTCACTCGAGTGAGGAGAGATCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372348
OR52I1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily I, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-647s1c1
Sequence:CCGGCCTTCATTGCTGCCTCCTATACTCGAGTATAGGAGGCAGCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-537s1c1
Sequence:CCGGCCACTCCTACTGTAAGCACATCTCGAGATGTGCTTACAGTAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-284s1c1
Sequence:CCGGCCATCAGCTTTAGTGCTTGTTCTCGAGAACAAGCACTAAAGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-484s1c1
Sequence:CCGGCCACTGAGTTGGATGATGAATCTCGAGATTCATCATCCAACTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-495s1c1
Sequence:CCGGGATGATGAATCATCTACCTTTCTCGAGAAAGGTAGATGATTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-655s1c1
Sequence:CCGGGCTGCCTCCTATATCTTAATTCTCGAGAATTAAGATATAGGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-682s1c1
Sequence:CCGGGCAGTATTTGATCTCTCCTCACTCGAGTGAGGAGAGATCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372348
OR52I1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily I, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-647s1c1
Sequence:CCGGCCTTCATTGCTGCCTCCTATACTCGAGTATAGGAGGCAGCAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-537s1c1
Sequence:CCGGCCACTCCTACTGTAAGCACATCTCGAGATGTGCTTACAGTAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-284s1c1
Sequence:CCGGCCATCAGCTTTAGTGCTTGTTCTCGAGAACAAGCACTAAAGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-484s1c1
Sequence:CCGGCCACTGAGTTGGATGATGAATCTCGAGATTCATCATCCAACTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-495s1c1
Sequence:CCGGGATGATGAATCATCTACCTTTCTCGAGAAAGGTAGATGATTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-655s1c1
Sequence:CCGGGCTGCCTCCTATATCTTAATTCTCGAGAATTAAGATATAGGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187628    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372348.1-682s1c1
Sequence:CCGGGCAGTATTTGATCTCTCCTCACTCGAGTGAGGAGAGATCAAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks