EMAIL THIS PAGE TO A FRIEND

OR52L1

olfactory receptor, family 52, subfamily L, member 1

Synonyms: OR11-50
UniProtKB ID: Q8NGH7, B2RPA6, Q6IFK9
Gene ID:
Human(338751) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(512314) olfactory receptor, family 52, subfamily L, member 1
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301966 ANTI-OR52L1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005173 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147731 MISSION® esiRNA esiRNA human OR52L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005173 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105567 predicted 752
2 SASI_Hs01_00105568 predicted 741
3 SASI_Hs01_00105569 predicted 668
4 SASI_Hs01_00105570 predicted 758
5 SASI_Hs01_00105571 predicted 309
6 SASI_Hs01_00105572 predicted 683
7 SASI_Hs01_00105573 predicted 543
8 SASI_Hs01_00105574 predicted 293
9 SASI_Hs01_00105575 predicted 660
10 SASI_Hs01_00105576 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005173
OR52L1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily L, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-219s1c1
Sequence:CCGGGCACCAATCTATGTACCTCTTCTCGAGAAGAGGTACATAGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-802s1c1
Sequence:CCGGGTCTTCTATGTCCCTGGAATTCTCGAGAATTCCAGGGACATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-27s1c1
Sequence:CCGGCCTCTCCAAGCCATTGATAATCTCGAGATTATCAATGGCTTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-163s1c1
Sequence:CCGGCTTGCTTTAGTGGGCAATGTTCTCGAGAACATTGCCCACTAAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-618s1c1
Sequence:CCGGCTGCTCAGAAACCACAGTCAACTCGAGTTGACTGTGGTTTCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005173
OR52L1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily L, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-219s1c1
Sequence:CCGGGCACCAATCTATGTACCTCTTCTCGAGAAGAGGTACATAGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-802s1c1
Sequence:CCGGGTCTTCTATGTCCCTGGAATTCTCGAGAATTCCAGGGACATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-27s1c1
Sequence:CCGGCCTCTCCAAGCCATTGATAATCTCGAGATTATCAATGGCTTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-163s1c1
Sequence:CCGGCTTGCTTTAGTGGGCAATGTTCTCGAGAACATTGCCCACTAAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-618s1c1
Sequence:CCGGCTGCTCAGAAACCACAGTCAACTCGAGTTGACTGTGGTTTCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005173
OR52L1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily L, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-219s1c1
Sequence:CCGGGCACCAATCTATGTACCTCTTCTCGAGAAGAGGTACATAGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-802s1c1
Sequence:CCGGGTCTTCTATGTCCCTGGAATTCTCGAGAATTCCAGGGACATAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-27s1c1
Sequence:CCGGCCTCTCCAAGCCATTGATAATCTCGAGATTATCAATGGCTTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-163s1c1
Sequence:CCGGCTTGCTTTAGTGGGCAATGTTCTCGAGAACATTGCCCACTAAAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005173.1-618s1c1
Sequence:CCGGCTGCTCAGAAACCACAGTCAACTCGAGTTGACTGTGGTTTCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks