EMAIL THIS PAGE TO A FRIEND

OR52N2

olfactory receptor, family 52, subfamily N, member 2

Synonyms: OR11-57
UniProtKB ID: Q8NGI0, Q6IFF9
Gene ID:
Human(390077) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(787652) olfactory receptor, family 52, subfamily N, member 2
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301895 ANTI-OR52N2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372365 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049191 MISSION® esiRNA esiRNA human OR52N2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005174 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131011 predicted 256
2 SASI_Hs01_00131012 predicted 240
3 SASI_Hs01_00131013 predicted 616
4 SASI_Hs01_00131016 predicted 436
5 SASI_Hs01_00131018 predicted 581
6 SASI_Hs01_00131020 predicted 266
7 SASI_Hs02_00304733 predicted 455
8 SASI_Hs02_00304734 predicted 626
9 SASI_Hs01_00131014 predicted 197
10 SASI_Hs01_00131017 predicted 433
11 SASI_Hs01_00131015 predicted 679
12 SASI_Hs01_00131019 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372365
OR52N2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 52, subfamily N, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-31s1c1
Sequence:CCGGCCAGGATTCTTTATCTTGAATCTCGAGATTCAAGATAAAGAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-531s1c1
Sequence:CCGGCCACACCTACTGTGACCATATCTCGAGATATGGTCACAGTAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-270s1c2
Sequence:CCGGCCTCAAGGAGATTGACTTTAACTCGAGTTAAAGTCAATCTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-613s1c1
Sequence:CCGGGCTCTCCTGATTGGTGTGTTTCTCGAGAAACACACCAATCAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372365
OR52N2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 52, subfamily N, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-31s1c1
Sequence:CCGGCCAGGATTCTTTATCTTGAATCTCGAGATTCAAGATAAAGAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-531s1c1
Sequence:CCGGCCACACCTACTGTGACCATATCTCGAGATATGGTCACAGTAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-270s1c2
Sequence:CCGGCCTCAAGGAGATTGACTTTAACTCGAGTTAAAGTCAATCTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-613s1c1
Sequence:CCGGGCTCTCCTGATTGGTGTGTTTCTCGAGAAACACACCAATCAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372365
OR52N2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 52, subfamily N, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-31s1c1
Sequence:CCGGCCAGGATTCTTTATCTTGAATCTCGAGATTCAAGATAAAGAATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-531s1c1
Sequence:CCGGCCACACCTACTGTGACCATATCTCGAGATATGGTCACAGTAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-270s1c2
Sequence:CCGGCCTCAAGGAGATTGACTTTAACTCGAGTTAAAGTCAATCTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372365.1-613s1c1
Sequence:CCGGGCTCTCCTGATTGGTGTGTTTCTCGAGAAACACACCAATCAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks