EMAIL THIS PAGE TO A FRIEND

OR5AU1

olfactory receptor, family 5, subfamily AU, member 1

Synonyms: OR14-38
UniProtKB ID: Q8NGC0, B2RP78, Q6IEU2, Q96R10
Gene ID:
Human(390445) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(519183) olfactory receptor, family 5, subfamily AU, member 1
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501713 Anti-OR5AU1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004731 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004731 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021754 predicted 440
2 SASI_Hs01_00021755 predicted 657
3 SASI_Hs01_00021756 predicted 630
4 SASI_Hs01_00021757 predicted 777
5 SASI_Hs01_00021758 predicted 602
6 SASI_Hs01_00021759 predicted 697
7 SASI_Hs01_00021760 predicted 722
8 SASI_Hs01_00021761 predicted 512
9 SASI_Hs01_00021762 predicted 599
10 SASI_Hs01_00021763 predicted 445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004731
OR5AU1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily AU, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-635s1c1
Sequence:CCGGGCTGTATCTTTAGTCTGAAATCTCGAGATTTCAGACTAAAGATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-413s1c1
Sequence:CCGGCCAAGAGGAAAGTGATCTCTTCTCGAGAAGAGATCACTTTCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-604s1c1
Sequence:CCGGGCAGGATTCCTCAATTCTCTTCTCGAGAAGAGAATTGAGGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-30s1c1
Sequence:CCGGGCCCTCAATAAGACTCATCTTCTCGAGAAGATGAGTCTTATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-92s1c1
Sequence:CCGGCCAGGTGTTCAACCTCATTTACTCGAGTAAATGAGGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004731
OR5AU1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily AU, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-635s1c1
Sequence:CCGGGCTGTATCTTTAGTCTGAAATCTCGAGATTTCAGACTAAAGATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-413s1c1
Sequence:CCGGCCAAGAGGAAAGTGATCTCTTCTCGAGAAGAGATCACTTTCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-604s1c1
Sequence:CCGGGCAGGATTCCTCAATTCTCTTCTCGAGAAGAGAATTGAGGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-30s1c1
Sequence:CCGGGCCCTCAATAAGACTCATCTTCTCGAGAAGATGAGTCTTATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-92s1c1
Sequence:CCGGCCAGGTGTTCAACCTCATTTACTCGAGTAAATGAGGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004731
OR5AU1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily AU, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-635s1c1
Sequence:CCGGGCTGTATCTTTAGTCTGAAATCTCGAGATTTCAGACTAAAGATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-413s1c1
Sequence:CCGGCCAAGAGGAAAGTGATCTCTTCTCGAGAAGAGATCACTTTCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-604s1c1
Sequence:CCGGGCAGGATTCCTCAATTCTCTTCTCGAGAAGAGAATTGAGGAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-30s1c1
Sequence:CCGGGCCCTCAATAAGACTCATCTTCTCGAGAAGATGAGTCTTATTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004731.1-92s1c1
Sequence:CCGGCCAGGTGTTCAACCTCATTTACTCGAGTAAATGAGGTTGAACACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks