EMAIL THIS PAGE TO A FRIEND

OR5B12

olfactory receptor, family 5, subfamily B, member 12

Synonyms: OR11-241 OR5B12P OR5B16 OST743
UniProtKB ID: Q96R08, B2RNL2, Q6IEV5
Gene ID:
Human(390191) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483467) cOR5B25 olfactory receptor family 5 subfamily B-like gene
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372409 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004733 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221292 predicted 283
2 SASI_Hs01_00221293 predicted 192
3 SASI_Hs01_00221294 predicted 352
4 SASI_Hs01_00221295 predicted 350
5 SASI_Hs01_00221296 predicted 246
6 SASI_Hs01_00221298 predicted 278
7 SASI_Hs01_00221299 predicted 307
8 SASI_Hs01_00221301 predicted 273
9 SASI_Hs02_00304691 predicted 239
10 SASI_Hs01_00221297 predicted 254
11 SASI_Hs01_00221300 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372409
OR5B12 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily B, member 12
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-70s1c1
Sequence:CCGGCCACTCTTCATAGTCTTCCTTCTCGAGAAGGAAGACTATGAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-753s1c1
Sequence:CCGGGACAGGAATCTTTATGTACTTCTCGAGAAGTACATAAAGATTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-395s1c1
Sequence:CCGGCCACCATGACAACAAATGTATCTCGAGATACATTTGTTGTCATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-489s1c1
Sequence:CCGGGCTCTCCTTCTGTAGATCCAACTCGAGTTGGATCTACAGAAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372409
OR5B12 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily B, member 12
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-70s1c1
Sequence:CCGGCCACTCTTCATAGTCTTCCTTCTCGAGAAGGAAGACTATGAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-753s1c1
Sequence:CCGGGACAGGAATCTTTATGTACTTCTCGAGAAGTACATAAAGATTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-395s1c1
Sequence:CCGGCCACCATGACAACAAATGTATCTCGAGATACATTTGTTGTCATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-489s1c1
Sequence:CCGGGCTCTCCTTCTGTAGATCCAACTCGAGTTGGATCTACAGAAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372409
OR5B12 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily B, member 12
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-70s1c1
Sequence:CCGGCCACTCTTCATAGTCTTCCTTCTCGAGAAGGAAGACTATGAAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-753s1c1
Sequence:CCGGGACAGGAATCTTTATGTACTTCTCGAGAAGTACATAAAGATTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-395s1c1
Sequence:CCGGCCACCATGACAACAAATGTATCTCGAGATACATTTGTTGTCATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372409.1-489s1c1
Sequence:CCGGGCTCTCCTTCTGTAGATCCAACTCGAGTTGGATCTACAGAAGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks