EMAIL THIS PAGE TO A FRIEND

OR5B17

olfactory receptor, family 5, subfamily B, member 17

Synonyms: OR11-237 OR5B20P
UniProtKB ID: Q8NGF7, Q6IEX1
Gene ID:
Human(219965) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(509369) uncharacterized LOC509369
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302088 ANTI-OR5B17 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166923 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005489 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304950 predicted 697
2 SASI_Hs01_00163086 predicted 502
3 SASI_Hs01_00163087 predicted 554
4 SASI_Hs01_00163089 predicted 570
5 SASI_Hs01_00163090 predicted 580
6 SASI_Hs01_00163091 predicted 636
7 SASI_Hs01_00163092 predicted 503
8 SASI_Hs02_00304951 predicted 631
9 SASI_Hs01_00163093 predicted 543
10 SASI_Hs01_00163094 predicted 425
11 SASI_Hs01_00163088 predicted 457
12 SASI_Hs01_00163095 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166923
OR5B17 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily B, member 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-114s1c1
Sequence:CCGGCCTGCTAAGTGTTGAGAGTAACTCGAGTTACTCTCAACACTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-832s1c1
Sequence:CCGGGCACTTCTTGTTACCTTGATTCTCGAGAATCAAGGTAACAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-93s1c1
Sequence:CCGGCCAACCCTCAATATCTGATATCTCGAGATATCAGATATTGAGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-670s1c1
Sequence:CCGGGCTTCTATCCAAATTGGAGATCTCGAGATCTCCAATTTGGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-166s1c1
Sequence:CCGGGATTGTTTCAACACAAGAGTACTCGAGTACTCTTGTGTTGAAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-671s1c1
Sequence:CCGGCTTCTATCCAAATTGGAGATACTCGAGTATCTCCAATTTGGATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-179s1c1
Sequence:CCGGCAAGAGTATCTTGTGATTCTACTCGAGTAGAATCACAAGATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166923
OR5B17 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily B, member 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-114s1c1
Sequence:CCGGCCTGCTAAGTGTTGAGAGTAACTCGAGTTACTCTCAACACTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-832s1c1
Sequence:CCGGGCACTTCTTGTTACCTTGATTCTCGAGAATCAAGGTAACAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-93s1c1
Sequence:CCGGCCAACCCTCAATATCTGATATCTCGAGATATCAGATATTGAGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-670s1c1
Sequence:CCGGGCTTCTATCCAAATTGGAGATCTCGAGATCTCCAATTTGGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-166s1c1
Sequence:CCGGGATTGTTTCAACACAAGAGTACTCGAGTACTCTTGTGTTGAAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-671s1c1
Sequence:CCGGCTTCTATCCAAATTGGAGATACTCGAGTATCTCCAATTTGGATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-179s1c1
Sequence:CCGGCAAGAGTATCTTGTGATTCTACTCGAGTAGAATCACAAGATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166923
OR5B17 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily B, member 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-114s1c1
Sequence:CCGGCCTGCTAAGTGTTGAGAGTAACTCGAGTTACTCTCAACACTTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-832s1c1
Sequence:CCGGGCACTTCTTGTTACCTTGATTCTCGAGAATCAAGGTAACAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187055    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-93s1c1
Sequence:CCGGCCAACCCTCAATATCTGATATCTCGAGATATCAGATATTGAGGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186847    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-670s1c1
Sequence:CCGGGCTTCTATCCAAATTGGAGATCTCGAGATCTCCAATTTGGATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-166s1c1
Sequence:CCGGGATTGTTTCAACACAAGAGTACTCGAGTACTCTTGTGTTGAAACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-671s1c1
Sequence:CCGGCTTCTATCCAAATTGGAGATACTCGAGTATCTCCAATTTGGATAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166923.4-179s1c1
Sequence:CCGGCAAGAGTATCTTGTGATTCTACTCGAGTAGAATCACAAGATACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks