EMAIL THIS PAGE TO A FRIEND

OR5B21

olfactory receptor, family 5, subfamily B, member 21

UniProtKB ID: A6NL26
Gene ID:
Human(219968) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483466) olfactory receptor, family 5, subfamily B, member 21
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166926 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138331 MISSION® esiRNA esiRNA human OR5B21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005218 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137551 predicted 369
2 SASI_Hs01_00137553 predicted 418
3 SASI_Hs01_00137554 predicted 615
4 SASI_Hs01_00137555 predicted 362
5 SASI_Hs01_00137556 predicted 575
6 SASI_Hs01_00137557 predicted 660
7 SASI_Hs01_00137558 predicted 261
8 SASI_Hs01_00137552 predicted 493
9 SASI_Hs01_00137559 predicted 624
10 SASI_Hs01_00137560 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166926
OR5B21 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily B, member 21
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-621s1c1
Sequence:CCGGCTATGGCACAATCATCTTCATCTCGAGATGAAGATGATTGTGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-375s1c1
Sequence:CCGGCTGTGGTTCTAATGAGATTAACTCGAGTTAATCTCATTAGAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-614s1c1
Sequence:CCGGCCATCTTCTATGGCACAATCACTCGAGTGATTGTGCCATAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-450s1c1
Sequence:CCGGCATCAGCAAGTTGGTGGTCTTCTCGAGAAGACCACCAACTTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166926
OR5B21 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily B, member 21
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-621s1c1
Sequence:CCGGCTATGGCACAATCATCTTCATCTCGAGATGAAGATGATTGTGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-375s1c1
Sequence:CCGGCTGTGGTTCTAATGAGATTAACTCGAGTTAATCTCATTAGAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-614s1c1
Sequence:CCGGCCATCTTCTATGGCACAATCACTCGAGTGATTGTGCCATAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-450s1c1
Sequence:CCGGCATCAGCAAGTTGGTGGTCTTCTCGAGAAGACCACCAACTTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166926
OR5B21 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily B, member 21
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-621s1c1
Sequence:CCGGCTATGGCACAATCATCTTCATCTCGAGATGAAGATGATTGTGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-375s1c1
Sequence:CCGGCTGTGGTTCTAATGAGATTAACTCGAGTTAATCTCATTAGAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-614s1c1
Sequence:CCGGCCATCTTCTATGGCACAATCACTCGAGTGATTGTGCCATAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166926.2-450s1c1
Sequence:CCGGCATCAGCAAGTTGGTGGTCTTCTCGAGAAGACCACCAACTTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks