EMAIL THIS PAGE TO A FRIEND

OR5D16

olfactory receptor, family 5, subfamily D, member 16

Synonyms: OR11-154
Species: Human OR5D16(390144)
UniProtKB ID: Q8NGK9, Q6IF65, Q96RB4
Gene ID:
Human(390144) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372388 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005496 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304961 predicted 320
2 SASI_Hs01_00219572 predicted 633
3 SASI_Hs01_00219573 predicted 543
4 SASI_Hs01_00219575 predicted 270
5 SASI_Hs01_00219576 predicted 616
6 SASI_Hs01_00219577 predicted 651
7 SASI_Hs01_00219578 predicted 312
8 SASI_Hs02_00304962 predicted 315
9 SASI_Hs01_00219579 predicted 627
10 SASI_Hs01_00219580 predicted 537
11 SASI_Hs01_00219574 predicted 568
12 SASI_Hs01_00219581 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372388
OR5D16 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily D, member 16
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000188034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372388.1-288s1c1
Sequence:CCGGCTCAGGATGTTTGGTGCAATTCTCGAGAATTGCACCAAACATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372388.1-198s1c1
Sequence:CCGGCCACCTCTCCTTTGTGGATTTCTCGAGAAATCCACAAAGGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372388
OR5D16 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily D, member 16
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000188034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372388.1-288s1c1
Sequence:CCGGCTCAGGATGTTTGGTGCAATTCTCGAGAATTGCACCAAACATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372388.1-198s1c1
Sequence:CCGGCCACCTCTCCTTTGTGGATTTCTCGAGAAATCCACAAAGGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372388
OR5D16 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily D, member 16
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000188034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372388.1-288s1c1
Sequence:CCGGCTCAGGATGTTTGGTGCAATTCTCGAGAATTGCACCAAACATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372388.1-198s1c1
Sequence:CCGGCCACCTCTCCTTTGTGGATTTCTCGAGAAATCCACAAAGGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks