EMAIL THIS PAGE TO A FRIEND

OR5D18

olfactory receptor, family 5, subfamily D, member 18

Synonyms: OR11-143
UniProtKB ID: Q8NGL1, Q6IF67, Q6IFD3, Q96RB3
Gene ID:
Human(219438) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483557) olfactory receptor, family 5, subfamily D, member 18
cow(515520) olfactory receptor, family 5, subfamily D, member 18
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166879 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001952 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140347 predicted 655
2 SASI_Hs01_00140348 predicted 592
3 SASI_Hs01_00140349 predicted 673
4 SASI_Hs01_00140350 predicted 465
5 SASI_Hs01_00140351 predicted 237
6 SASI_Hs01_00140352 predicted 641
7 SASI_Hs01_00140353 predicted 309
8 SASI_Hs01_00140355 predicted 644
9 SASI_Hs01_00140356 predicted 631
10 SASI_Hs02_00304023 predicted 637
11 SASI_Hs01_00140354 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166879
OR5D18 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily D, member 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-771s1c1
Sequence:CCGGCTTCCTTTACTGTGTGCCCAACTCGAGTTGGGCACACAGTAAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-387s1c1
Sequence:CCGGCCCTCTGCTCTACACAGTTAACTCGAGTTAACTGTGTAGAGCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-663s1c1
Sequence:CCGGCATTGTTGTAACCATCCTCAACTCGAGTTGAGGATGGTTACAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-508s1c1
Sequence:CCGGCATGGTTTCAACACAATCAATCTCGAGATTGATTGTGTTGAAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-589s1c1
Sequence:CCGGCAGTGGCTGCTATTCTTTCTTCTCGAGAAGAAAGAATAGCAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166879
OR5D18 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily D, member 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-771s1c1
Sequence:CCGGCTTCCTTTACTGTGTGCCCAACTCGAGTTGGGCACACAGTAAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-387s1c1
Sequence:CCGGCCCTCTGCTCTACACAGTTAACTCGAGTTAACTGTGTAGAGCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-663s1c1
Sequence:CCGGCATTGTTGTAACCATCCTCAACTCGAGTTGAGGATGGTTACAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-508s1c1
Sequence:CCGGCATGGTTTCAACACAATCAATCTCGAGATTGATTGTGTTGAAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-589s1c1
Sequence:CCGGCAGTGGCTGCTATTCTTTCTTCTCGAGAAGAAAGAATAGCAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166879
OR5D18 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily D, member 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-771s1c1
Sequence:CCGGCTTCCTTTACTGTGTGCCCAACTCGAGTTGGGCACACAGTAAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-387s1c1
Sequence:CCGGCCCTCTGCTCTACACAGTTAACTCGAGTTAACTGTGTAGAGCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-663s1c1
Sequence:CCGGCATTGTTGTAACCATCCTCAACTCGAGTTGAGGATGGTTACAACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-508s1c1
Sequence:CCGGCATGGTTTCAACACAATCAATCTCGAGATTGATTGTGTTGAAACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166879.1-589s1c1
Sequence:CCGGCAGTGGCTGCTATTCTTTCTTCTCGAGAAGAAAGAATAGCAGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks