EMAIL THIS PAGE TO A FRIEND

OR5H1

olfactory receptor, family 5, subfamily H, member 1

Synonyms: HSHTPCRX14 HTPCRX14
Species: Human OR5H1(26341)
UniProtKB ID: A6NKK0
Gene ID:
Human(26341) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
4 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501135 Anti-OR5H1, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005338 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230441 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005338
OR5H1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 5, subfamily H, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-540s1c1
Sequence:CCGGCACTATCCCATTGTCTAAGATCTCGAGATCTTAGACAATGGGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-385s1c1
Sequence:CCGGCCTTTACTTTATCCAGCCATTCTCGAGAATGGCTGGATAAAGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-606s1c1
Sequence:CCGGCTCAGGTTCAATTCAGGTATTCTCGAGAATACCTGAATTGAACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-243s1c1
Sequence:CCGGGCTGAATAACTTCTTAGCTAACTCGAGTTAGCTAAGAAGTTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-629s1c1
Sequence:CCGGGCATTGTGACTATTCTTGTATCTCGAGATACAAGAATAGTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005338
OR5H1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 5, subfamily H, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-540s1c1
Sequence:CCGGCACTATCCCATTGTCTAAGATCTCGAGATCTTAGACAATGGGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-385s1c1
Sequence:CCGGCCTTTACTTTATCCAGCCATTCTCGAGAATGGCTGGATAAAGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-606s1c1
Sequence:CCGGCTCAGGTTCAATTCAGGTATTCTCGAGAATACCTGAATTGAACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-243s1c1
Sequence:CCGGGCTGAATAACTTCTTAGCTAACTCGAGTTAGCTAAGAAGTTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-629s1c1
Sequence:CCGGGCATTGTGACTATTCTTGTATCTCGAGATACAAGAATAGTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005338
OR5H1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 5, subfamily H, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-540s1c1
Sequence:CCGGCACTATCCCATTGTCTAAGATCTCGAGATCTTAGACAATGGGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-385s1c1
Sequence:CCGGCCTTTACTTTATCCAGCCATTCTCGAGAATGGCTGGATAAAGTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-606s1c1
Sequence:CCGGCTCAGGTTCAATTCAGGTATTCTCGAGAATACCTGAATTGAACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-243s1c1
Sequence:CCGGGCTGAATAACTTCTTAGCTAACTCGAGTTAGCTAAGAAGTTATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005338.1-629s1c1
Sequence:CCGGGCATTGTGACTATTCTTGTATCTCGAGATACAAGAATAGTCACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks