EMAIL THIS PAGE TO A FRIEND

OR6K3

olfactory receptor, family 6, subfamily K, member 3

Synonyms: OR1-18
UniProtKB ID: Q8NGY3, Q5VUV0, Q6IFR5
Gene ID:
Human(391114) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(514540) olfactory receptor, family 6, subfamily K, member 3
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372800 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372800 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372800 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005327 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118896 predicted 647
2 SASI_Hs01_00118897 predicted 547
3 SASI_Hs01_00118898 predicted 614
4 SASI_Hs01_00118899 predicted 478
5 SASI_Hs01_00118900 predicted 427
6 SASI_Hs01_00118901 predicted 576
7 SASI_Hs01_00118902 predicted 337
8 SASI_Hs01_00118903 predicted 618
9 SASI_Hs01_00118904 predicted 626
10 SASI_Hs02_00304843 predicted 428
11 SASI_Hs01_00118905 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372800
OR6K3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily K, member 3
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000202625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-615s1c1
Sequence:CCGGCATCATCATTACCTTCCTAATCTCGAGATTAGGAAGGTAATGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-380s1c1
Sequence:CCGGGCAACCCTCTTCGCTATCAAACTCGAGTTTGATAGCGAAGAGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-785s1c1
Sequence:CCGGGCGACACTTATCCACCAGTTTCTCGAGAAACTGGTGGATAAGTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372800
OR6K3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily K, member 3
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000202625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-615s1c1
Sequence:CCGGCATCATCATTACCTTCCTAATCTCGAGATTAGGAAGGTAATGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-380s1c1
Sequence:CCGGGCAACCCTCTTCGCTATCAAACTCGAGTTTGATAGCGAAGAGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-785s1c1
Sequence:CCGGGCGACACTTATCCACCAGTTTCTCGAGAAACTGGTGGATAAGTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372800
OR6K3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily K, member 3
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000202625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-615s1c1
Sequence:CCGGCATCATCATTACCTTCCTAATCTCGAGATTAGGAAGGTAATGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-380s1c1
Sequence:CCGGGCAACCCTCTTCGCTATCAAACTCGAGTTTGATAGCGAAGAGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372800.1-785s1c1
Sequence:CCGGGCGACACTTATCCACCAGTTTCTCGAGAAACTGGTGGATAAGTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks