EMAIL THIS PAGE TO A FRIEND

OR6N1

olfactory receptor, family 6, subfamily N, member 1

Synonyms: OR1-22
UniProtKB ID: Q8NGY5, Q5VUU8, Q96R35
Gene ID:
Human(128372) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(488618) olfactory receptor, family 6, subfamily N, member 1
cow(517209) olfactory receptor, family 6, subfamily N, member 1
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900543 Anti-OR6N1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB2900544 Anti-OR6N1 antibody produced in rabbit affinity isolated antibody hamster, rabbit, rat, mouse, human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_060957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_060957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_060957 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005185 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010641 predicted 568
2 SASI_Hs01_00010642 predicted 463
3 SASI_Hs01_00010643 predicted 559
4 SASI_Hs01_00010644 predicted 569
5 SASI_Hs02_00304752 predicted 240
6 SASI_Hs01_00010645 predicted 461
7 SASI_Hs01_00010647 predicted 329
8 SASI_Hs01_00010648 predicted 464
9 SASI_Hs01_00010649 predicted 555
10 SASI_Hs02_00304753 predicted 323
11 SASI_Hs01_00010646 predicted 269
12 SASI_Hs01_00010650 predicted 204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_060957
OR6N1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 6, subfamily N, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-350s1c1
Sequence:CCGGCTATGGCCTACGATAGGTATTCTCGAGAATACCTATCGTAGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-412s1c1
Sequence:CCGGCCAACACTTTGTGCAGAGATTCTCGAGAATCTCTGCACAAAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-411s1c1
Sequence:CCGGCCCAACACTTTGTGCAGAGATCTCGAGATCTCTGCACAAAGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-460s1c1
Sequence:CCGGGCTGGGCCAGTAGTTGAAATTCTCGAGAATTTCAACTACTGGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-69s1c1
Sequence:CCGGCCAGATTTATCTCTTCCTCTTCTCGAGAAGAGGAAGAGATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_060957
OR6N1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 6, subfamily N, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-350s1c1
Sequence:CCGGCTATGGCCTACGATAGGTATTCTCGAGAATACCTATCGTAGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-412s1c1
Sequence:CCGGCCAACACTTTGTGCAGAGATTCTCGAGAATCTCTGCACAAAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-411s1c1
Sequence:CCGGCCCAACACTTTGTGCAGAGATCTCGAGATCTCTGCACAAAGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-460s1c1
Sequence:CCGGGCTGGGCCAGTAGTTGAAATTCTCGAGAATTTCAACTACTGGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-69s1c1
Sequence:CCGGCCAGATTTATCTCTTCCTCTTCTCGAGAAGAGGAAGAGATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_060957
OR6N1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 6, subfamily N, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-350s1c1
Sequence:CCGGCTATGGCCTACGATAGGTATTCTCGAGAATACCTATCGTAGGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-412s1c1
Sequence:CCGGCCAACACTTTGTGCAGAGATTCTCGAGAATCTCTGCACAAAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-411s1c1
Sequence:CCGGCCCAACACTTTGTGCAGAGATCTCGAGATCTCTGCACAAAGTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-460s1c1
Sequence:CCGGGCTGGGCCAGTAGTTGAAATTCTCGAGAATTTCAACTACTGGCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060957.2-69s1c1
Sequence:CCGGCCAGATTTATCTCTTCCTCTTCTCGAGAAGAGGAAGAGATAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks