EMAIL THIS PAGE TO A FRIEND

OR8H3

olfactory receptor, family 8, subfamily H, member 3

Synonyms: OR11-172
UniProtKB ID: Q8N146, Q6IFB7
Gene ID:
Human(390152) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(617362) olfactory receptor, family 8, subfamily H, member 3
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501695 Anti-OR8H3, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372391 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005201 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186483 predicted 496
2 SASI_Hs01_00186484 predicted 566
3 SASI_Hs01_00186485 predicted 575
4 SASI_Hs01_00186486 predicted 567
5 SASI_Hs01_00186482 predicted 563
6 SASI_Hs01_00186487 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372391
OR8H3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily H, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-629s1c1
Sequence:CCGGCCCTTATCACAATATCTGCATCTCGAGATGCAGATATTGTGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-579s1c1
Sequence:CCGGCAACACTGAAATGCTGATATTCTCGAGAATATCAGCATTTCAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-252s1c1
Sequence:CCGGGAACTTACTGACTTCCAACTACTCGAGTAGTTGGAAGTCAGTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-385s1c1
Sequence:CCGGCCTCTACACTACACAGTTATTCTCGAGAATAACTGTGTAGTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-577s1c1
Sequence:CCGGGACAACACTGAAATGCTGATACTCGAGTATCAGCATTTCAGTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-165s1c1
Sequence:CCGGGCTTCACACTCCCATGTATTTCTCGAGAAATACATGGGAGTGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372391
OR8H3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily H, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-629s1c1
Sequence:CCGGCCCTTATCACAATATCTGCATCTCGAGATGCAGATATTGTGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-579s1c1
Sequence:CCGGCAACACTGAAATGCTGATATTCTCGAGAATATCAGCATTTCAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-252s1c1
Sequence:CCGGGAACTTACTGACTTCCAACTACTCGAGTAGTTGGAAGTCAGTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-385s1c1
Sequence:CCGGCCTCTACACTACACAGTTATTCTCGAGAATAACTGTGTAGTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-577s1c1
Sequence:CCGGGACAACACTGAAATGCTGATACTCGAGTATCAGCATTTCAGTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-165s1c1
Sequence:CCGGGCTTCACACTCCCATGTATTTCTCGAGAAATACATGGGAGTGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372391
OR8H3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily H, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-629s1c1
Sequence:CCGGCCCTTATCACAATATCTGCATCTCGAGATGCAGATATTGTGATAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-579s1c1
Sequence:CCGGCAACACTGAAATGCTGATATTCTCGAGAATATCAGCATTTCAGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-252s1c1
Sequence:CCGGGAACTTACTGACTTCCAACTACTCGAGTAGTTGGAAGTCAGTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-385s1c1
Sequence:CCGGCCTCTACACTACACAGTTATTCTCGAGAATAACTGTGTAGTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-577s1c1
Sequence:CCGGGACAACACTGAAATGCTGATACTCGAGTATCAGCATTTCAGTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372391.1-165s1c1
Sequence:CCGGGCTTCACACTCCCATGTATTTCTCGAGAAATACATGGGAGTGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks