EMAIL THIS PAGE TO A FRIEND

OR8J1

olfactory receptor, family 8, subfamily J, member 1

Synonyms: OR11-183
UniProtKB ID: Q8NGP2, B2RNQ6, B9EH63, Q6IFC2, Q96RC3
Gene ID:
Human(219477) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(522150) olfactory receptor, family 8, subfamily J, member 1
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166829 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005205 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241336 predicted 585
2 SASI_Hs01_00241337 predicted 466
3 SASI_Hs01_00241339 predicted 583
4 SASI_Hs01_00241340 predicted 459
5 SASI_Hs01_00241341 predicted 200
6 SASI_Hs01_00241342 predicted 721
7 SASI_Hs01_00241343 predicted 576
8 SASI_Hs01_00241344 predicted 626
9 SASI_Hs01_00241345 predicted 472
10 SASI_Hs02_00304780 predicted 722
11 SASI_Hs01_00241338 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166829
OR8J1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 8, subfamily J, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-318s1c1
Sequence:CCGGCTTTATTGTATCGGAGGTAATCTCGAGATTACCTCCGATACAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-583s1c1
Sequence:CCGGCCAGAAACAGTTGTCTTTATACTCGAGTATAAAGACAACTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-787s1c1
Sequence:CCGGCGAAGTAACCATTCACTGGATCTCGAGATCCAGTGAATGGTTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-466s1c1
Sequence:CCGGGCTATTGTGGTTTCATCTTATCTCGAGATAAGATGAAACCACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166829
OR8J1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 8, subfamily J, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-318s1c1
Sequence:CCGGCTTTATTGTATCGGAGGTAATCTCGAGATTACCTCCGATACAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-583s1c1
Sequence:CCGGCCAGAAACAGTTGTCTTTATACTCGAGTATAAAGACAACTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-787s1c1
Sequence:CCGGCGAAGTAACCATTCACTGGATCTCGAGATCCAGTGAATGGTTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-466s1c1
Sequence:CCGGGCTATTGTGGTTTCATCTTATCTCGAGATAAGATGAAACCACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166829
OR8J1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 8, subfamily J, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-318s1c1
Sequence:CCGGCTTTATTGTATCGGAGGTAATCTCGAGATTACCTCCGATACAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-583s1c1
Sequence:CCGGCCAGAAACAGTTGTCTTTATACTCGAGTATAAAGACAACTGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187372    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-787s1c1
Sequence:CCGGCGAAGTAACCATTCACTGGATCTCGAGATCCAGTGAATGGTTACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_166829.2-466s1c1
Sequence:CCGGGCTATTGTGGTTTCATCTTATCTCGAGATAAGATGAAACCACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks