EMAIL THIS PAGE TO A FRIEND

OR9A2

olfactory receptor, family 9, subfamily A, member 2

Species: Human OR9A2(135924)
UniProtKB ID: Q8NGT5, B9EH51, Q6IF71, Q8NGD9
Gene ID:
Human(135924) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_069609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_069609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_069609 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001658 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051138 predicted 401
2 SASI_Hs01_00051139 predicted 400
3 SASI_Hs01_00051140 predicted 477
4 SASI_Hs01_00051142 predicted 553
5 SASI_Hs01_00051143 predicted 479
6 SASI_Hs01_00051144 predicted 311
7 SASI_Hs02_00303853 predicted 495
8 SASI_Hs01_00051146 predicted 333
9 SASI_Hs01_00051147 predicted 258
10 SASI_Hs02_00303854 predicted 560
11 SASI_Hs01_00051141 predicted 202
12 SASI_Hs01_00051145 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_069609
OR9A2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 9, subfamily A, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-55s1c1
Sequence:CCGGCAAGGACTACACCACATTCTTCTCGAGAAGAATGTGGTGTAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-627s1c2
Sequence:CCGGGATTGTCTCCTACACCTACATCTCGAGATGTAGGTGTAGGAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-485s1c1
Sequence:CCGGCCTTCCGCAAATCAAATTCATCTCGAGATGAATTTGATTTGCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-370s1c1
Sequence:CCGGCCTTTGAGGTACAACATCATTCTCGAGAATGATGTTGTACCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-714s1c1
Sequence:CCGGCCACTTCACCTGTGTTGTGATCTCGAGATCACAACACAGGTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-537s1c1
Sequence:CCGGGCTCAAACTGTCCTGCGATAACTCGAGTTATCGCAGGACAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_069609
OR9A2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 9, subfamily A, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-55s1c1
Sequence:CCGGCAAGGACTACACCACATTCTTCTCGAGAAGAATGTGGTGTAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-627s1c2
Sequence:CCGGGATTGTCTCCTACACCTACATCTCGAGATGTAGGTGTAGGAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-485s1c1
Sequence:CCGGCCTTCCGCAAATCAAATTCATCTCGAGATGAATTTGATTTGCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-370s1c1
Sequence:CCGGCCTTTGAGGTACAACATCATTCTCGAGAATGATGTTGTACCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-714s1c1
Sequence:CCGGCCACTTCACCTGTGTTGTGATCTCGAGATCACAACACAGGTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-537s1c1
Sequence:CCGGGCTCAAACTGTCCTGCGATAACTCGAGTTATCGCAGGACAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_069609
OR9A2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 9, subfamily A, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-55s1c1
Sequence:CCGGCAAGGACTACACCACATTCTTCTCGAGAAGAATGTGGTGTAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-627s1c2
Sequence:CCGGGATTGTCTCCTACACCTACATCTCGAGATGTAGGTGTAGGAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-485s1c1
Sequence:CCGGCCTTCCGCAAATCAAATTCATCTCGAGATGAATTTGATTTGCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-370s1c1
Sequence:CCGGCCTTTGAGGTACAACATCATTCTCGAGAATGATGTTGTACCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-714s1c1
Sequence:CCGGCCACTTCACCTGTGTTGTGATCTCGAGATCACAACACAGGTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_069609.5-537s1c1
Sequence:CCGGGCTCAAACTGTCCTGCGATAACTCGAGTTATCGCAGGACAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks