EMAIL THIS PAGE TO A FRIEND

OR9G4

olfactory receptor, family 9, subfamily G, member 4

Synonyms: OR11-216
UniProtKB ID: Q8NGQ1, Q6IF62, Q96RA9
Gene ID:
Human(283189) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483506) cOR9G4 olfactory receptor family 9 subfamily G-like
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_210193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_210193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_210193 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005284 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142074 predicted 409
2 SASI_Hs01_00142075 predicted 413
3 SASI_Hs01_00142076 predicted 581
4 SASI_Hs01_00142077 predicted 523
5 SASI_Hs01_00142079 predicted 245
6 SASI_Hs01_00142081 predicted 350
7 SASI_Hs01_00142082 predicted 453
8 SASI_Hs01_00142083 predicted 665
9 SASI_Hs02_00304832 predicted 509
10 SASI_Hs02_00304833 predicted 678
11 SASI_Hs01_00142078 predicted 474
12 SASI_Hs01_00142080 predicted 481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_210193
OR9G4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 9, subfamily G, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-247s1c1
Sequence:CCGGGCCAGTTGTGTCTCAGAAGATCTCGAGATCTTCTGAGACACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-374s1c1
Sequence:CCGGCAATTTGTAACCCATTGCTTTCTCGAGAAAGCAATGGGTTACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-373s1c1
Sequence:CCGGGCAATTTGTAACCCATTGCTTCTCGAGAAGCAATGGGTTACAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-627s1c1
Sequence:CCGGCAGCATTCTTGCTATCCTGATCTCGAGATCAGGATAGCAAGAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-72s1c1
Sequence:CCGGGCCGATTCTATTTGGAGTGTTCTCGAGAACACTCCAAATAGAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_210193
OR9G4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 9, subfamily G, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-247s1c1
Sequence:CCGGGCCAGTTGTGTCTCAGAAGATCTCGAGATCTTCTGAGACACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-374s1c1
Sequence:CCGGCAATTTGTAACCCATTGCTTTCTCGAGAAAGCAATGGGTTACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-373s1c1
Sequence:CCGGGCAATTTGTAACCCATTGCTTCTCGAGAAGCAATGGGTTACAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-627s1c1
Sequence:CCGGCAGCATTCTTGCTATCCTGATCTCGAGATCAGGATAGCAAGAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-72s1c1
Sequence:CCGGGCCGATTCTATTTGGAGTGTTCTCGAGAACACTCCAAATAGAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_210193
OR9G4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 9, subfamily G, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-247s1c1
Sequence:CCGGGCCAGTTGTGTCTCAGAAGATCTCGAGATCTTCTGAGACACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-374s1c1
Sequence:CCGGCAATTTGTAACCCATTGCTTTCTCGAGAAAGCAATGGGTTACAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-373s1c1
Sequence:CCGGGCAATTTGTAACCCATTGCTTCTCGAGAAGCAATGGGTTACAAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-627s1c1
Sequence:CCGGCAGCATTCTTGCTATCCTGATCTCGAGATCAGGATAGCAAGAATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_210193.3-72s1c1
Sequence:CCGGGCCGATTCTATTTGGAGTGTTCTCGAGAACACTCCAAATAGAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks