EMAIL THIS PAGE TO A FRIEND

OSBPL9

oxysterol binding protein-like 9

Synonyms: ORP-9 ORP9
Gene ID:
Human(114883) Summary: This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Mouse(100273) oxysterol binding protein-like 9
Rat(298369) oxysterol binding protein-like 9
Zebrafish(777767) oxysterol binding protein-like 9
cow(511255) oxysterol binding protein-like 9
Horse(100051050) oxysterol binding protein-like 9
domestic cat(101091545) oxysterol binding protein-like 9
dog(475355) oxysterol binding protein-like 9
chicken(424634) oxysterol binding protein-like 9
sheep(101110886) oxysterol binding protein-like 9
naked mole-rat(101717078) oxysterol binding protein-like 9
domestic guinea pig(100721760) oxysterol binding protein-like 9
203 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024586 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024586 Rosetta Predictions human pricing
NM_148904 Rosetta Predictions human pricing
NM_148905 Rosetta Predictions human pricing
NM_148906 Rosetta Predictions human pricing
NM_148907 Rosetta Predictions human pricing
NM_148908 Rosetta Predictions human pricing
NM_148909 Rosetta Predictions human pricing
NM_001044234 Rosetta Predictions rat pricing
NM_133885 Rosetta Predictions mouse pricing
NM_173350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193892 predicted 1762
2 SASI_Hs02_00356921 predicted 1398
3 SASI_Hs01_00193893 predicted 1168
4 SASI_Hs01_00193894 predicted 1575
5 SASI_Hs01_00193895 predicted 1948
6 SASI_Hs01_00193896 predicted 1300
7 SASI_Hs01_00193897 predicted 1156
8 SASI_Hs01_00193898 predicted 1655
9 SASI_Hs02_00356922 predicted 1780
10 SASI_Hs01_00193900 predicted 1726
11 SASI_Hs01_00193899 predicted 1973
12 SASI_Hs01_00193901 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051978 predicted 1699
2 SASI_Hs02_00365624 predicted 1332
3 SASI_Hs01_00051979 predicted 1091
4 SASI_Hs01_00051980 predicted 1504
5 SASI_Hs01_00051981 predicted 1873
6 SASI_Hs01_00051982 predicted 1228
7 SASI_Hs01_00051983 predicted 1080
8 SASI_Hs01_00051984 predicted 1590
9 SASI_Hs02_00365625 predicted 1703
10 SASI_Hs01_00051986 predicted 1656
11 SASI_Hs01_00051985 predicted 1905
12 SASI_Hs01_00051987 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240376 predicted 1598
2 SASI_Hs02_00365626 predicted 1232
3 SASI_Hs01_00240377 predicted 991
4 SASI_Hs01_00240378 predicted 1413
5 SASI_Hs01_00240379 predicted 1775
6 SASI_Hs01_00240380 predicted 1134
7 SASI_Hs01_00240381 predicted 992
8 SASI_Hs01_00240382 predicted 1487
9 SASI_Hs02_00365627 predicted 1606
10 SASI_Hs01_00240384 predicted 1560
11 SASI_Hs01_00240383 predicted 1812
12 SASI_Hs01_00240385 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233421 predicted 1691
2 SASI_Hs02_00365628 predicted 1328
3 SASI_Hs01_00233422 predicted 1083
4 SASI_Hs01_00233423 predicted 1503
5 SASI_Hs01_00233424 predicted 1862
6 SASI_Hs01_00233425 predicted 1218
7 SASI_Hs01_00233426 predicted 1073
8 SASI_Hs01_00233427 predicted 1578
9 SASI_Hs02_00365629 predicted 1695
10 SASI_Hs01_00233429 predicted 1648
11 SASI_Hs01_00233428 predicted 1891
12 SASI_Hs01_00233430 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065110 predicted 1541
2 SASI_Hs02_00365630 predicted 1176
3 SASI_Hs01_00065111 predicted 938
4 SASI_Hs01_00065112 predicted 1357
5 SASI_Hs01_00065113 predicted 1716
6 SASI_Hs01_00065114 predicted 1073
7 SASI_Hs01_00065115 predicted 928
8 SASI_Hs01_00065116 predicted 1433
9 SASI_Hs02_00365631 predicted 1547
10 SASI_Hs01_00065118 predicted 1503
11 SASI_Hs01_00065117 predicted 1755
12 SASI_Hs01_00065119 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013004 predicted 1727
2 SASI_Hs02_00365632 predicted 1360
3 SASI_Hs01_00013005 predicted 1127
4 SASI_Hs01_00013006 predicted 1543
5 SASI_Hs01_00013007 predicted 1907
6 SASI_Hs01_00013008 predicted 1257
7 SASI_Hs01_00013009 predicted 1121
8 SASI_Hs01_00013010 predicted 1614
9 SASI_Hs02_00365633 predicted 1733
10 SASI_Hs01_00013012 predicted 1689
11 SASI_Hs01_00013011 predicted 1934
12 SASI_Hs01_00013013 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141692 predicted 1801
2 SASI_Hs02_00365634 predicted 1430
3 SASI_Hs01_00141693 predicted 1193
4 SASI_Hs01_00141694 predicted 1612
5 SASI_Hs01_00141695 predicted 1973
6 SASI_Hs01_00141696 predicted 1327
7 SASI_Hs01_00141697 predicted 1184
8 SASI_Hs01_00141698 predicted 1684
9 SASI_Hs02_00365635 predicted 1803
10 SASI_Hs01_00141700 predicted 1762
11 SASI_Hs01_00141699 predicted 2010
12 SASI_Hs01_00141701 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205067 predicted 1507
2 SASI_Rn02_00205068 predicted 1523
3 SASI_Rn02_00205069 predicted 479
4 SASI_Rn02_00205070 predicted 782
5 SASI_Rn02_00205071 predicted 1806
6 SASI_Rn02_00205072 predicted 2265
7 SASI_Rn02_00205073 predicted 1415
8 SASI_Rn02_00205074 predicted 1379
9 SASI_Rn02_00205075 predicted 1672
10 SASI_Rn02_00205076 predicted 2077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076741 predicted 1168
2 SASI_Mm01_00076742 predicted 1179
3 SASI_Mm01_00076743 predicted 737
4 SASI_Mm01_00076744 predicted 1879
5 SASI_Mm01_00076745 predicted 447
6 SASI_Mm01_00076746 predicted 1463
7 SASI_Mm01_00076748 predicted 907
8 SASI_Mm01_00076749 predicted 613
9 SASI_Mm01_00076750 predicted 1460
10 SASI_Mm02_00338942 predicted 1383
11 SASI_Mm01_00076747 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052489 predicted 1246
2 SASI_Mm01_00052490 predicted 1268
3 SASI_Mm01_00052491 predicted 822
4 SASI_Mm01_00052492 predicted 1964
5 SASI_Mm01_00052493 predicted 527
6 SASI_Mm01_00052494 predicted 1549
7 SASI_Mm01_00052496 predicted 985
8 SASI_Mm01_00052497 predicted 705
9 SASI_Mm01_00052498 predicted 1538
10 SASI_Mm02_00345169 predicted 1468
11 SASI_Mm01_00052495 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133885
VALIDATED
OSBPL9 MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1521s1c1
Sequence:CCGGGAATGGTATCATGTATGCAAACTCGAGTTTGCATACATGATACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133885.1-1203s1c1
Sequence:CCGGCAATGCTCATATCTGGACTAACTCGAGTTAGTCCAGATATGAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1419s1c1
Sequence:CCGGCTTCCACACTAAGCCTTTCTACTCGAGTAGAAAGGCTTAGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-575s1c1
Sequence:CCGGGCTTAATAGATTCTTCTGGATCTCGAGATCCAGAAGAATCTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1988s1c1
Sequence:CCGGCGACACAGATGAACAATTAAACTCGAGTTTAATTGTTCATCTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-577s21c1
Sequence:CCGGTAATCCTGTAGATGCAATATACTCGAGTATATTGCATCTACAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-1915s21c1
Sequence:CCGGCACCAAGAAATTGCCTATAATCTCGAGATTATAGGCAATTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-915s21c1
Sequence:CCGGGCTTAATAGATTCTTCTGGATCTCGAGATCCAGAAGAATCTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-1759s21c1
Sequence:CCGGCTTCCACACTAAGCCTTTCTACTCGAGTAGAAAGGCTTAGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133885.3-2328s21c1
Sequence:CCGGCGACACAGATGAACAATTAAACTCGAGTTTAATTGTTCATCTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133885
VALIDATED
OSBPL9 MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1521s1c1
Sequence:CCGGGAATGGTATCATGTATGCAAACTCGAGTTTGCATACATGATACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133885.1-1203s1c1
Sequence:CCGGCAATGCTCATATCTGGACTAACTCGAGTTAGTCCAGATATGAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1419s1c1
Sequence:CCGGCTTCCACACTAAGCCTTTCTACTCGAGTAGAAAGGCTTAGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-575s1c1
Sequence:CCGGGCTTAATAGATTCTTCTGGATCTCGAGATCCAGAAGAATCTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1988s1c1
Sequence:CCGGCGACACAGATGAACAATTAAACTCGAGTTTAATTGTTCATCTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-577s21c1
Sequence:CCGGTAATCCTGTAGATGCAATATACTCGAGTATATTGCATCTACAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-1915s21c1
Sequence:CCGGCACCAAGAAATTGCCTATAATCTCGAGATTATAGGCAATTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-915s21c1
Sequence:CCGGGCTTAATAGATTCTTCTGGATCTCGAGATCCAGAAGAATCTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-1759s21c1
Sequence:CCGGCTTCCACACTAAGCCTTTCTACTCGAGTAGAAAGGCTTAGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133885.3-2328s21c1
Sequence:CCGGCGACACAGATGAACAATTAAACTCGAGTTTAATTGTTCATCTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133885
VALIDATED
OSBPL9 MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1521s1c1
Sequence:CCGGGAATGGTATCATGTATGCAAACTCGAGTTTGCATACATGATACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133885.1-1203s1c1
Sequence:CCGGCAATGCTCATATCTGGACTAACTCGAGTTAGTCCAGATATGAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1419s1c1
Sequence:CCGGCTTCCACACTAAGCCTTTCTACTCGAGTAGAAAGGCTTAGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-575s1c1
Sequence:CCGGGCTTAATAGATTCTTCTGGATCTCGAGATCCAGAAGAATCTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133885.1-1988s1c1
Sequence:CCGGCGACACAGATGAACAATTAAACTCGAGTTTAATTGTTCATCTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-577s21c1
Sequence:CCGGTAATCCTGTAGATGCAATATACTCGAGTATATTGCATCTACAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-1915s21c1
Sequence:CCGGCACCAAGAAATTGCCTATAATCTCGAGATTATAGGCAATTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-915s21c1
Sequence:CCGGGCTTAATAGATTCTTCTGGATCTCGAGATCCAGAAGAATCTATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133885.3-1759s21c1
Sequence:CCGGCTTCCACACTAAGCCTTTCTACTCGAGTAGAAAGGCTTAGTGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133885.3-2328s21c1
Sequence:CCGGCGACACAGATGAACAATTAAACTCGAGTTTAATTGTTCATCTGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024586
OSBPL9 MISSION shRNA Bacterial Glycerol Stock
oxysterol binding protein-like 9
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-841s1c1
Sequence:CCGGCCACGTGAACTTGTCTCCAAACTCGAGTTTGGAGACAAGTTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2311s1c1
Sequence:CCGGCCTGTTCATTCCAATCTTCTACTCGAGTAGAAGATTGGAATGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1946s1c1
Sequence:CCGGGATACCAAGAAGTTGCCTATACTCGAGTATAGGCAACTTCTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1825s1c1
Sequence:CCGGGCACAGAATTACTGCCGAGATCTCGAGATCTCGGCAGTAATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2496s1c1
Sequence:CCGGCCACACGTTGAAAGCATTTATCTCGAGATAAATGCTTTCAACGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2537s1c1
Sequence:CCGGGCGCTCTAGTACTGCTGTTAACTCGAGTTAACAGCAGTACTAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1304s1c1
Sequence:CCGGCGAATGGTTCAGGTTGTGAAACTCGAGTTTCACAACCTGAACCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1826s1c1
Sequence:CCGGCACAGAATTACTGCCGAGATTCTCGAGAATCTCGGCAGTAATTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-2020s1c1
Sequence:CCGGCCTTTGGAAGGATGTCACTTTCTCGAGAAAGTGACATCCTTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-2019s1c1
Sequence:CCGGGCCTTTGGAAGGATGTCACTTCTCGAGAAGTGACATCCTTCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-1304s21c1
Sequence:CCGGCGAATGGTTCAGGTTGTGAAACTCGAGTTTCACAACCTGAACCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-1825s21c1
Sequence:CCGGGCACAGAATTACTGCCGAGATCTCGAGATCTCGGCAGTAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024586.3-2537s21c1
Sequence:CCGGGCGCTCTAGTACTGCTGTTAACTCGAGTTAACAGCAGTACTAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-2019s21c1
Sequence:CCGGGCCTTTGGAAGGATGTCACTTCTCGAGAAGTGACATCCTTCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024586
OSBPL9 MISSION shRNA shRNA Plasmid DNA
oxysterol binding protein-like 9
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-841s1c1
Sequence:CCGGCCACGTGAACTTGTCTCCAAACTCGAGTTTGGAGACAAGTTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2311s1c1
Sequence:CCGGCCTGTTCATTCCAATCTTCTACTCGAGTAGAAGATTGGAATGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1946s1c1
Sequence:CCGGGATACCAAGAAGTTGCCTATACTCGAGTATAGGCAACTTCTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1825s1c1
Sequence:CCGGGCACAGAATTACTGCCGAGATCTCGAGATCTCGGCAGTAATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2496s1c1
Sequence:CCGGCCACACGTTGAAAGCATTTATCTCGAGATAAATGCTTTCAACGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2537s1c1
Sequence:CCGGGCGCTCTAGTACTGCTGTTAACTCGAGTTAACAGCAGTACTAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1304s1c1
Sequence:CCGGCGAATGGTTCAGGTTGTGAAACTCGAGTTTCACAACCTGAACCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1826s1c1
Sequence:CCGGCACAGAATTACTGCCGAGATTCTCGAGAATCTCGGCAGTAATTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-2020s1c1
Sequence:CCGGCCTTTGGAAGGATGTCACTTTCTCGAGAAAGTGACATCCTTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-2019s1c1
Sequence:CCGGGCCTTTGGAAGGATGTCACTTCTCGAGAAGTGACATCCTTCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-1304s21c1
Sequence:CCGGCGAATGGTTCAGGTTGTGAAACTCGAGTTTCACAACCTGAACCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-1825s21c1
Sequence:CCGGGCACAGAATTACTGCCGAGATCTCGAGATCTCGGCAGTAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024586.3-2537s21c1
Sequence:CCGGGCGCTCTAGTACTGCTGTTAACTCGAGTTAACAGCAGTACTAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-2019s21c1
Sequence:CCGGGCCTTTGGAAGGATGTCACTTCTCGAGAAGTGACATCCTTCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024586
OSBPL9 MISSION shRNA Lentiviral Transduction Particles
oxysterol binding protein-like 9
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-841s1c1
Sequence:CCGGCCACGTGAACTTGTCTCCAAACTCGAGTTTGGAGACAAGTTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159533    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2311s1c1
Sequence:CCGGCCTGTTCATTCCAATCTTCTACTCGAGTAGAAGATTGGAATGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1946s1c1
Sequence:CCGGGATACCAAGAAGTTGCCTATACTCGAGTATAGGCAACTTCTTGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1825s1c1
Sequence:CCGGGCACAGAATTACTGCCGAGATCTCGAGATCTCGGCAGTAATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2496s1c1
Sequence:CCGGCCACACGTTGAAAGCATTTATCTCGAGATAAATGCTTTCAACGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024586.3-2537s1c1
Sequence:CCGGGCGCTCTAGTACTGCTGTTAACTCGAGTTAACAGCAGTACTAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1304s1c1
Sequence:CCGGCGAATGGTTCAGGTTGTGAAACTCGAGTTTCACAACCTGAACCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-1826s1c1
Sequence:CCGGCACAGAATTACTGCCGAGATTCTCGAGAATCTCGGCAGTAATTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-2020s1c1
Sequence:CCGGCCTTTGGAAGGATGTCACTTTCTCGAGAAAGTGACATCCTTCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024586.3-2019s1c1
Sequence:CCGGGCCTTTGGAAGGATGTCACTTCTCGAGAAGTGACATCCTTCCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-1304s21c1
Sequence:CCGGCGAATGGTTCAGGTTGTGAAACTCGAGTTTCACAACCTGAACCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-1825s21c1
Sequence:CCGGGCACAGAATTACTGCCGAGATCTCGAGATCTCGGCAGTAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024586.3-2537s21c1
Sequence:CCGGGCGCTCTAGTACTGCTGTTAACTCGAGTTAACAGCAGTACTAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024586.3-2019s21c1
Sequence:CCGGGCCTTTGGAAGGATGTCACTTCTCGAGAAGTGACATCCTTCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks