EMAIL THIS PAGE TO A FRIEND

OSR2

odd-skipped related 2 (Drosophila)

UniProtKB ID: Q8N2R0, A8K626, Q96AM6, Q96LB6, Q96LB7
Gene ID:
Human(116039) Summary: OSR2 is a mammalian homolog of the Drosophila odd-skipped family of transcription factors (Lan et al., 2004 [PubMed 15175245]
Mouse(107587) odd-skipped related 2
Rat(315039) odd-skipped related 2 (Drosophila)
naked mole-rat(101715811) odd-skipped related 2 (Drosophila)
domestic guinea pig(100712614) odd-skipped related 2 (Drosophila)
sheep(101105924) odd-skipped related 2 (Drosophila)
Zebrafish(550389) odd-skipped related 2 (Drosophila)
chicken(771523) odd-skipped related 2 (Drosophila)
domestic cat(101096202) odd-skipped related 2 (Drosophila)
cow(508692) odd-skipped related 2 (Drosophila)
Horse(100055727) odd-skipped related 2 (Drosophila)
dog(481980) odd-skipped related 2 (Drosophila)
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053001 Rosetta Predictions human pricing
NM_001012118 Rosetta Predictions rat pricing
XM_576247 Rosetta Predictions rat pricing
NM_054049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032500 predicted 932
2 SASI_Hs02_00361828 predicted 1083
3 SASI_Hs01_00032501 predicted 1023
4 SASI_Hs01_00032502 predicted 1283
5 SASI_Hs01_00032503 predicted 958
6 SASI_Hs01_00032504 predicted 1213
7 SASI_Hs01_00032505 predicted 618
8 SASI_Hs01_00032506 predicted 629
9 SASI_Hs01_00032507 predicted 1166
10 SASI_Hs02_00361829 predicted 1247
11 SASI_Hs01_00032499 predicted 1046
12 SASI_Hs01_00032508 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200278 predicted 504
2 SASI_Rn01_00041075 predicted 890
3 SASI_Rn01_00041077 predicted 651
4 SASI_Rn01_00041079 predicted 497
5 SASI_Rn01_00041081 predicted 833
6 SASI_Rn01_00041082 predicted 968
7 SASI_Rn01_00041084 predicted 1111
8 SASI_Rn02_00200279 predicted 594
9 SASI_Rn02_00200280 predicted 655
10 SASI_Rn02_00200281 predicted 828
11 SASI_Rn01_00041076 predicted 1059
12 SASI_Rn01_00041078 predicted 646
13 SASI_Rn01_00041080 predicted 1104
14 SASI_Rn01_00041083 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184805 predicted 504
2 SASI_Rn01_00184806 predicted 480
3 SASI_Rn01_00184807 predicted 502
4 SASI_Rn01_00184808 predicted 582
5 SASI_Rn01_00184809 predicted 552
6 SASI_Rn01_00184810 predicted 484
7 SASI_Rn01_00184811 predicted 517
8 SASI_Rn01_00184812 predicted 487
9 SASI_Rn01_00184813 predicted 554
10 SASI_Rn01_00184814 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337954 predicted 1230
2 SASI_Mm01_00023749 predicted 1011
3 SASI_Mm01_00023750 predicted 900
4 SASI_Mm02_00337955 predicted 1180
5 SASI_Mm01_00023751 predicted 835
6 SASI_Mm01_00023752 predicted 644
7 SASI_Mm02_00337956 predicted 1474
8 SASI_Mm02_00337957 predicted 501
9 SASI_Mm02_00337958 predicted 975
10 SASI_Mm02_00337959 predicted 507
11 SASI_Mm01_00023753 predicted 1006
12 SASI_Mm01_00023754 predicted 999
13 SASI_Mm01_00023755 predicted 1118
14 SASI_Mm01_00023756 predicted 1000
15 SASI_Mm01_00023757 predicted 1125
16 SASI_Mm01_00023758 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054049
OSR2 MISSION shRNA Bacterial Glycerol Stock
odd-skipped related 2 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-1254s21c1
Sequence:CCGGGCAAAGTGTTCAGGCGAAACTCTCGAGAGTTTCGCCTGAACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-1183s21c1
Sequence:CCGGAGTCTAGGACCCTAGCAGTTCCTCGAGGAACTGCTAGGGTCCTAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054049.2-1451s21c1
Sequence:CCCGTGCAGCTCCAGGGAGTTAACTCTCGAGAGTTAACTCCCTGGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-919s21c1
Sequence:CCGGGTAAACTGAACCCGGACAGAACTCGAGTTCTGTCCGGGTTCAGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054049.1-1546s1c1
Sequence:CCGGGTAGATATTCACGGCTCATTTCTCGAGAAATGAGCCGTGAATATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-1119s1c1
Sequence:CCGGCACAGGTATATCCATTCCAAACTCGAGTTTGGAATGGATATACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-841s1c1
Sequence:CCGGCCACGCAAGAAGATCCTCCTACTCGAGTAGGAGGATCTTCTTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-1000s1c1
Sequence:CCGGGCAGACACTTTACCAAATCATCTCGAGATGATTTGGTAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-997s1c1
Sequence:CCGGGCGGCAGACACTTTACCAAATCTCGAGATTTGGTAAAGTGTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054049
OSR2 MISSION shRNA shRNA Plasmid DNA
odd-skipped related 2 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-1254s21c1
Sequence:CCGGGCAAAGTGTTCAGGCGAAACTCTCGAGAGTTTCGCCTGAACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-1183s21c1
Sequence:CCGGAGTCTAGGACCCTAGCAGTTCCTCGAGGAACTGCTAGGGTCCTAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054049.2-1451s21c1
Sequence:CCCGTGCAGCTCCAGGGAGTTAACTCTCGAGAGTTAACTCCCTGGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-919s21c1
Sequence:CCGGGTAAACTGAACCCGGACAGAACTCGAGTTCTGTCCGGGTTCAGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054049.1-1546s1c1
Sequence:CCGGGTAGATATTCACGGCTCATTTCTCGAGAAATGAGCCGTGAATATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-1119s1c1
Sequence:CCGGCACAGGTATATCCATTCCAAACTCGAGTTTGGAATGGATATACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-841s1c1
Sequence:CCGGCCACGCAAGAAGATCCTCCTACTCGAGTAGGAGGATCTTCTTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-1000s1c1
Sequence:CCGGGCAGACACTTTACCAAATCATCTCGAGATGATTTGGTAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-997s1c1
Sequence:CCGGGCGGCAGACACTTTACCAAATCTCGAGATTTGGTAAAGTGTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054049
OSR2 MISSION shRNA Lentiviral Transduction Particles
odd-skipped related 2 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-1254s21c1
Sequence:CCGGGCAAAGTGTTCAGGCGAAACTCTCGAGAGTTTCGCCTGAACACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-1183s21c1
Sequence:CCGGAGTCTAGGACCCTAGCAGTTCCTCGAGGAACTGCTAGGGTCCTAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054049.2-1451s21c1
Sequence:CCCGTGCAGCTCCAGGGAGTTAACTCTCGAGAGTTAACTCCCTGGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054049.2-919s21c1
Sequence:CCGGGTAAACTGAACCCGGACAGAACTCGAGTTCTGTCCGGGTTCAGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054049.1-1546s1c1
Sequence:CCGGGTAGATATTCACGGCTCATTTCTCGAGAAATGAGCCGTGAATATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-1119s1c1
Sequence:CCGGCACAGGTATATCCATTCCAAACTCGAGTTTGGAATGGATATACCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-841s1c1
Sequence:CCGGCCACGCAAGAAGATCCTCCTACTCGAGTAGGAGGATCTTCTTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-1000s1c1
Sequence:CCGGGCAGACACTTTACCAAATCATCTCGAGATGATTTGGTAAAGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054049.1-997s1c1
Sequence:CCGGGCGGCAGACACTTTACCAAATCTCGAGATTTGGTAAAGTGTCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053001
OSR2 MISSION shRNA Bacterial Glycerol Stock
odd-skipped related 2 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053001.2-1605s21c1
Sequence:CCGGATGCTAGTTTCTTGTAGATATCTCGAGATATCTACAAGAAACTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053001.2-1650s21c1
Sequence:CCGGACATAATGTTGTGGGTCTTTGCTCGAGCAAAGACCCACAACATTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053001.2-913s21c1
Sequence:CCGGGCAAGAGGATCCGCCTAAGATCTCGAGATCTTAGGCGGATCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-1143s1c1
Sequence:CCGGCGGGATCACAGATACATCCATCTCGAGATGGATGTATCTGTGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-1282s1c1
Sequence:CCGGCGGCAAAGTGTTCAGGCGAAACTCGAGTTTCGCCTGAACACTTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-629s1c1
Sequence:CCGGCGCGGTACAGACCATGCACATCTCGAGATGTGCATGGTCTGTACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-944s1c1
Sequence:CCGGCCTCAGTAAATTGACTCCGGACTCGAGTCCGGAGTCAATTTACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053001
OSR2 MISSION shRNA shRNA Plasmid DNA
odd-skipped related 2 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053001.2-1605s21c1
Sequence:CCGGATGCTAGTTTCTTGTAGATATCTCGAGATATCTACAAGAAACTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053001.2-1650s21c1
Sequence:CCGGACATAATGTTGTGGGTCTTTGCTCGAGCAAAGACCCACAACATTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053001.2-913s21c1
Sequence:CCGGGCAAGAGGATCCGCCTAAGATCTCGAGATCTTAGGCGGATCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-1143s1c1
Sequence:CCGGCGGGATCACAGATACATCCATCTCGAGATGGATGTATCTGTGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-1282s1c1
Sequence:CCGGCGGCAAAGTGTTCAGGCGAAACTCGAGTTTCGCCTGAACACTTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-629s1c1
Sequence:CCGGCGCGGTACAGACCATGCACATCTCGAGATGTGCATGGTCTGTACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-944s1c1
Sequence:CCGGCCTCAGTAAATTGACTCCGGACTCGAGTCCGGAGTCAATTTACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053001
OSR2 MISSION shRNA Lentiviral Transduction Particles
odd-skipped related 2 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053001.2-1605s21c1
Sequence:CCGGATGCTAGTTTCTTGTAGATATCTCGAGATATCTACAAGAAACTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053001.2-1650s21c1
Sequence:CCGGACATAATGTTGTGGGTCTTTGCTCGAGCAAAGACCCACAACATTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053001.2-913s21c1
Sequence:CCGGGCAAGAGGATCCGCCTAAGATCTCGAGATCTTAGGCGGATCCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-1143s1c1
Sequence:CCGGCGGGATCACAGATACATCCATCTCGAGATGGATGTATCTGTGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-1282s1c1
Sequence:CCGGCGGCAAAGTGTTCAGGCGAAACTCGAGTTTCGCCTGAACACTTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-629s1c1
Sequence:CCGGCGCGGTACAGACCATGCACATCTCGAGATGTGCATGGTCTGTACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053001.1-944s1c1
Sequence:CCGGCCTCAGTAAATTGACTCCGGACTCGAGTCCGGAGTCAATTTACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks