EMAIL THIS PAGE TO A FRIEND

OTOL1

otolin 1

Synonyms: C1QTNF15
UniProtKB ID: A6NHN0
Gene ID:
Mouse(229389) otolin 1 homolog (zebrafish)
Rat(295117) otolin 1
sheep(101103524) otolin 1
chicken(429161) otolin 1
dog(100683888) otolin 1
cow(525044) otolin 1
Horse(100062344) otolin 1
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001018031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001018031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080440 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU170951 MISSION® esiRNA esiRNA targeting mouse Otol1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080440 Rosetta Predictions human pricing
XM_001067275 Rosetta Predictions rat pricing
XM_227256 Rosetta Predictions rat pricing
NM_001018031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314866 predicted 1142
2 SASI_Hs02_00314867 predicted 1114
3 SASI_Hs02_00314868 predicted 1120
4 SASI_Hs02_00314869 predicted 267
5 SASI_Hs02_00314870 predicted 1104
6 SASI_Hs02_00314871 predicted 1119
7 SASI_Hs02_00314872 predicted 349
8 SASI_Hs02_00314873 predicted 1142
9 SASI_Hs02_00314874 predicted 1024
10 SASI_Hs02_00314875 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320482 predicted 321
2 SASI_Rn02_00320483 predicted 1017
3 SASI_Rn02_00320484 predicted 295
4 SASI_Rn02_00320485 predicted 1157
5 SASI_Rn02_00320486 predicted 1133
6 SASI_Rn02_00320487 predicted 1012
7 SASI_Rn02_00320488 predicted 494
8 SASI_Rn02_00320489 predicted 507
9 SASI_Rn02_00320490 predicted 1140
10 SASI_Rn02_00320491 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384187 predicted 321
2 SASI_Rn02_00384188 predicted 1018
3 SASI_Rn02_00384189 predicted 290
4 SASI_Rn02_00384190 predicted 1153
5 SASI_Rn02_00384191 predicted 1132
6 SASI_Rn02_00384192 predicted 1005
7 SASI_Rn02_00384193 predicted 495
8 SASI_Rn02_00384194 predicted 507
9 SASI_Rn02_00384195 predicted 1143
10 SASI_Rn02_00384196 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287543 predicted 1596
2 SASI_Mm01_00088976 predicted 1663
3 SASI_Mm01_00088978 predicted 1442
4 SASI_Mm01_00088979 predicted 1026
5 SASI_Mm01_00088980 predicted 1625
6 SASI_Mm01_00088981 predicted 422
7 SASI_Mm01_00088982 predicted 995
8 SASI_Mm01_00088983 predicted 1287
9 SASI_Mm01_00088984 predicted 1590
10 SASI_Mm02_00287544 predicted 1272
11 SASI_Mm01_00088975 predicted 1583
12 SASI_Mm01_00088977 predicted 1460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018031
OTOL1 MISSION shRNA Bacterial Glycerol Stock
otolin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018031.1-1715s1c1
Sequence:CCGGCCTATTTCAAACATCTCCATTCTCGAGAATGGAGATGTTTGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-427s1c1
Sequence:CCGGCTGGACACAACTGGTTTCGTTCTCGAGAACGAAACCAGTTGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-203s1c1
Sequence:CCGGCCACACCATACACCAAATTTACTCGAGTAAATTTGGTGTATGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-1215s1c1
Sequence:CCGGCGTTCCCATCAAGTTTGACAACTCGAGTTGTCAAACTTGATGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-1511s1c1
Sequence:CCGGCCGAGGATGACAGCATCTTTACTCGAGTAAAGATGCTGTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018031
OTOL1 MISSION shRNA shRNA Plasmid DNA
otolin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018031.1-1715s1c1
Sequence:CCGGCCTATTTCAAACATCTCCATTCTCGAGAATGGAGATGTTTGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-427s1c1
Sequence:CCGGCTGGACACAACTGGTTTCGTTCTCGAGAACGAAACCAGTTGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-203s1c1
Sequence:CCGGCCACACCATACACCAAATTTACTCGAGTAAATTTGGTGTATGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-1215s1c1
Sequence:CCGGCGTTCCCATCAAGTTTGACAACTCGAGTTGTCAAACTTGATGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-1511s1c1
Sequence:CCGGCCGAGGATGACAGCATCTTTACTCGAGTAAAGATGCTGTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018031
OTOL1 MISSION shRNA Lentiviral Transduction Particles
otolin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001018031.1-1715s1c1
Sequence:CCGGCCTATTTCAAACATCTCCATTCTCGAGAATGGAGATGTTTGAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-427s1c1
Sequence:CCGGCTGGACACAACTGGTTTCGTTCTCGAGAACGAAACCAGTTGTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-203s1c1
Sequence:CCGGCCACACCATACACCAAATTTACTCGAGTAAATTTGGTGTATGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-1215s1c1
Sequence:CCGGCGTTCCCATCAAGTTTGACAACTCGAGTTGTCAAACTTGATGGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018031.1-1511s1c1
Sequence:CCGGCCGAGGATGACAGCATCTTTACTCGAGTAAAGATGCTGTCATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080440
OTOL1 MISSION shRNA Bacterial Glycerol Stock
otolin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-1098s21c1
Sequence:CCGGCTATAATGACCAAGGGAATTACTCGAGTAATTCCCTTGGTCATTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-1123s21c1
Sequence:CCGGCCTGTCACTGGGAAGTTTAACCTCGAGGTTAAACTTCCCAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-46s21c1
Sequence:CCGGATTGCTGGTATGAACACAATACTCGAGTATTGTGTTCATACCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-929s21c1
Sequence:CCGGAGGGTGACATTGGCAACAAAGCTCGAGCTTTGTTGCCAATGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-73s21c1
Sequence:CCGGACCACACCACATACCAAATTTCTCGAGAAATTTGGTATGTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080440
OTOL1 MISSION shRNA shRNA Plasmid DNA
otolin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-1098s21c1
Sequence:CCGGCTATAATGACCAAGGGAATTACTCGAGTAATTCCCTTGGTCATTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-1123s21c1
Sequence:CCGGCCTGTCACTGGGAAGTTTAACCTCGAGGTTAAACTTCCCAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-46s21c1
Sequence:CCGGATTGCTGGTATGAACACAATACTCGAGTATTGTGTTCATACCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-929s21c1
Sequence:CCGGAGGGTGACATTGGCAACAAAGCTCGAGCTTTGTTGCCAATGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-73s21c1
Sequence:CCGGACCACACCACATACCAAATTTCTCGAGAAATTTGGTATGTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080440
OTOL1 MISSION shRNA Lentiviral Transduction Particles
otolin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-1098s21c1
Sequence:CCGGCTATAATGACCAAGGGAATTACTCGAGTAATTCCCTTGGTCATTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-1123s21c1
Sequence:CCGGCCTGTCACTGGGAAGTTTAACCTCGAGGTTAAACTTCCCAGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-46s21c1
Sequence:CCGGATTGCTGGTATGAACACAATACTCGAGTATTGTGTTCATACCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-929s21c1
Sequence:CCGGAGGGTGACATTGGCAACAAAGCTCGAGCTTTGTTGCCAATGTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080440.1-73s21c1
Sequence:CCGGACCACACCACATACCAAATTTCTCGAGAAATTTGGTATGTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks