EMAIL THIS PAGE TO A FRIEND

OTOR

otoraplin

Synonyms: FDP MIAL1
UniProtKB ID: Q9NRC9, D3DW22, Q3MIU6
Gene ID:
Human(56914) Summary: The protein encoded by this gene is secreted via the Golgi apparatus and may function in cartilage development and maintenance. A frequent polymorphism in the translation start codon of this gene can abolish translation and may be associated with forms of deafness. This gene is a member of the melanoma-inhibiting activity gene family. In addition, alternate polyA sites exist for this gene. [provided by RefSeq, Jul 2008]
Mouse(57329) otoraplin
Rat(366206) otoraplin
sheep(101112665) otoraplin
chicken(395484) otoraplin
cow(613456) otoraplin
dog(485758) otoraplin
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020157 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020157 Rosetta Predictions human pricing
NM_001108960 Rosetta Predictions rat pricing
NM_020595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143020 predicted 204
2 SASI_Hs02_00353055 predicted 853
3 SASI_Hs01_00143022 predicted 815
4 SASI_Hs01_00143023 predicted 700
5 SASI_Hs01_00143024 predicted 729
6 SASI_Hs01_00143025 predicted 732
7 SASI_Hs01_00143026 predicted 202
8 SASI_Hs01_00143028 predicted 747
9 SASI_Hs01_00143029 predicted 863
10 SASI_Hs02_00353056 predicted 777
11 SASI_Hs01_00143021 predicted 813
12 SASI_Hs01_00143027 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243784 predicted 521
2 SASI_Rn02_00243785 predicted 603
3 SASI_Rn02_00243786 predicted 599
4 SASI_Rn02_00243787 predicted 614
5 SASI_Rn02_00243788 predicted 602
6 SASI_Rn02_00243789 predicted 207
7 SASI_Rn02_00243790 predicted 463
8 SASI_Rn02_00243791 predicted 361
9 SASI_Rn02_00243792 predicted 288
10 SASI_Rn02_00243793 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066794 predicted 349
2 SASI_Mm01_00066795 predicted 637
3 SASI_Mm01_00066797 predicted 641
4 SASI_Mm01_00066798 predicted 586
5 SASI_Mm01_00066799 predicted 581
6 SASI_Mm01_00066800 predicted 194
7 SASI_Mm01_00066801 predicted 605
8 SASI_Mm01_00066802 predicted 280
9 SASI_Mm01_00066803 predicted 277
10 SASI_Mm02_00325692 predicted 588
11 SASI_Mm01_00066796 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020595
OTOR MISSION shRNA Bacterial Glycerol Stock
otoraplin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020595.2-750s1c1
Sequence:CCGGGCTGAGTTAGAAGTCTGACTTCTCGAGAAGTCAGACTTCTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-279s1c1
Sequence:CCGGCAGGATGAGATGGGAATTGTACTCGAGTACAATTCCCATCTCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-367s1c1
Sequence:CCGGCCACGGATATTGACTTCTTCTCTCGAGAGAAGAAGTCAATATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-185s1c1
Sequence:CCGGTGTCAAGAAAGGGCAGCAGATCTCGAGATCTGCTGCCCTTTCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-287s1c1
Sequence:CCGGGATGGGAATTGTAGGTTATTTCTCGAGAAATAACCTACAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020595
OTOR MISSION shRNA shRNA Plasmid DNA
otoraplin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020595.2-750s1c1
Sequence:CCGGGCTGAGTTAGAAGTCTGACTTCTCGAGAAGTCAGACTTCTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-279s1c1
Sequence:CCGGCAGGATGAGATGGGAATTGTACTCGAGTACAATTCCCATCTCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-367s1c1
Sequence:CCGGCCACGGATATTGACTTCTTCTCTCGAGAGAAGAAGTCAATATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-185s1c1
Sequence:CCGGTGTCAAGAAAGGGCAGCAGATCTCGAGATCTGCTGCCCTTTCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-287s1c1
Sequence:CCGGGATGGGAATTGTAGGTTATTTCTCGAGAAATAACCTACAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020595
OTOR MISSION shRNA Lentiviral Transduction Particles
otoraplin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020595.2-750s1c1
Sequence:CCGGGCTGAGTTAGAAGTCTGACTTCTCGAGAAGTCAGACTTCTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-279s1c1
Sequence:CCGGCAGGATGAGATGGGAATTGTACTCGAGTACAATTCCCATCTCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-367s1c1
Sequence:CCGGCCACGGATATTGACTTCTTCTCTCGAGAGAAGAAGTCAATATCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-185s1c1
Sequence:CCGGTGTCAAGAAAGGGCAGCAGATCTCGAGATCTGCTGCCCTTTCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020595.2-287s1c1
Sequence:CCGGGATGGGAATTGTAGGTTATTTCTCGAGAAATAACCTACAATTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020157
OTOR MISSION shRNA Bacterial Glycerol Stock
otoraplin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-401s1c1
Sequence:CCGGCACCACGGATATTGACTTCTTCTCGAGAAGAAGTCAATATCCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-140s1c1
Sequence:CCGGTGCAGATGATGAGTGTGTCTACTCGAGTAGACACACTCATCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-291s1c1
Sequence:CCGGGCTGGCAGTGTTTATGGTGATCTCGAGATCACCATAAACACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-200s1c1
Sequence:CCGGCCCGGACTGTAGATTCATTAACTCGAGTTAATGAATCTACAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020157.2-778s1c1
Sequence:CCGGCCCAGCTCTTTGATTTGCCATCTCGAGATGGCAAATCAAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020157.2-323s21c1
Sequence:CCGGGATGGGAGTCGTGGGTTATTTCTCGAGAAATAACCCACGACTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020157.2-176s21c1
Sequence:CCGGTAGTGCTCAAGAAGATTATAACTCGAGTTATAATCTTCTTGAGCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020157.2-740s21c1
Sequence:CCGGGATCATGTATGTGTAGTTATTCTCGAGAATAACTACACATACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020157.2-860s21c1
Sequence:CCGGCTCTGGCCAATTGAATTATTACTCGAGTAATAATTCAATTGGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020157
OTOR MISSION shRNA shRNA Plasmid DNA
otoraplin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-401s1c1
Sequence:CCGGCACCACGGATATTGACTTCTTCTCGAGAAGAAGTCAATATCCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-140s1c1
Sequence:CCGGTGCAGATGATGAGTGTGTCTACTCGAGTAGACACACTCATCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-291s1c1
Sequence:CCGGGCTGGCAGTGTTTATGGTGATCTCGAGATCACCATAAACACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-200s1c1
Sequence:CCGGCCCGGACTGTAGATTCATTAACTCGAGTTAATGAATCTACAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020157.2-778s1c1
Sequence:CCGGCCCAGCTCTTTGATTTGCCATCTCGAGATGGCAAATCAAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020157.2-323s21c1
Sequence:CCGGGATGGGAGTCGTGGGTTATTTCTCGAGAAATAACCCACGACTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020157.2-176s21c1
Sequence:CCGGTAGTGCTCAAGAAGATTATAACTCGAGTTATAATCTTCTTGAGCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020157.2-740s21c1
Sequence:CCGGGATCATGTATGTGTAGTTATTCTCGAGAATAACTACACATACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020157.2-860s21c1
Sequence:CCGGCTCTGGCCAATTGAATTATTACTCGAGTAATAATTCAATTGGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020157
OTOR MISSION shRNA Lentiviral Transduction Particles
otoraplin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-401s1c1
Sequence:CCGGCACCACGGATATTGACTTCTTCTCGAGAAGAAGTCAATATCCGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-140s1c1
Sequence:CCGGTGCAGATGATGAGTGTGTCTACTCGAGTAGACACACTCATCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-291s1c1
Sequence:CCGGGCTGGCAGTGTTTATGGTGATCTCGAGATCACCATAAACACTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020157.2-200s1c1
Sequence:CCGGCCCGGACTGTAGATTCATTAACTCGAGTTAATGAATCTACAGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020157.2-778s1c1
Sequence:CCGGCCCAGCTCTTTGATTTGCCATCTCGAGATGGCAAATCAAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020157.2-323s21c1
Sequence:CCGGGATGGGAGTCGTGGGTTATTTCTCGAGAAATAACCCACGACTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020157.2-176s21c1
Sequence:CCGGTAGTGCTCAAGAAGATTATAACTCGAGTTATAATCTTCTTGAGCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020157.2-740s21c1
Sequence:CCGGGATCATGTATGTGTAGTTATTCTCGAGAATAACTACACATACATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020157.2-860s21c1
Sequence:CCGGCTCTGGCCAATTGAATTATTACTCGAGTAATAATTCAATTGGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks