EMAIL THIS PAGE TO A FRIEND

OTUB1

OTU domain, ubiquitin aldehyde binding 1

Synonyms: OTB1 OTU1
UniProtKB ID: Q96FW1, Q32Q78, Q96II3, Q9NXQ4, Q9P0B8
Gene ID:
Human(55611) Summary: The product of this gene is a member of the OTU (ovarian tumor) superfamily of predicted cysteine proteases. The encoded protein is a highly specific ubiquitin iso-peptidase, and cleaves ubiquitin from branched poly-ubiquitin chains but not from ubiquitinated substrates. It interacts with another ubiquitin protease and an E3 ubiquitin ligase that inhibits cytokine gene transcription in the immune system. It is proposed to function in specific ubiquitin-dependent pathways, possibly by providing an editing function for polyubiquitin chain growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(107260) OTU domain, ubiquitin aldehyde binding 1
Rat(293705) OTU domain, ubiquitin aldehyde binding 1
chicken(777320) OTU domain, ubiquitin aldehyde binding 1
domestic cat(101096843) OTU domain, ubiquitin aldehyde binding 1
cow(540984) OTU domain, ubiquitin aldehyde binding 1
dog(611228) OTU domain, ubiquitin aldehyde binding 1
domestic guinea pig(100714472) OTU domain, ubiquitin aldehyde binding 1
naked mole-rat(101706271) OTU domain, ubiquitin aldehyde binding 1
sheep(101122063) OTU domain, ubiquitin aldehyde binding 1
147 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017670 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017670 Rosetta Predictions human pricing
NR_003089 Rosetta Predictions human pricing
NM_001106332 Rosetta Predictions rat pricing
NM_134150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080525 predicted 1160
2 SASI_Hs02_00350395 predicted 1786
3 SASI_Hs01_00080526 predicted 1106
4 SASI_Hs01_00080528 predicted 924
5 SASI_Hs02_00350396 predicted 657
6 SASI_Hs02_00350397 predicted 645
7 SASI_Hs02_00350398 predicted 652
8 SASI_Hs02_00350399 predicted 700
9 SASI_Hs01_00080530 predicted 1021
10 SASI_Hs01_00080531 predicted 757
11 SASI_Hs01_00080527 predicted 215
12 SASI_Hs01_00080529 predicted 726
13 SASI_Hs01_00080532 predicted 235
14 SASI_Hs01_00080533 predicted 463
15 SASI_Hs01_00080534 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378146 predicted 293
2 SASI_Hs02_00378147 predicted 451
3 SASI_Hs02_00378148 predicted 573
4 SASI_Hs02_00378149 predicted 582
5 SASI_Hs02_00378150 predicted 645
6 SASI_Hs02_00378151 predicted 654
7 SASI_Hs02_00378152 predicted 578
8 SASI_Hs02_00378153 predicted 297
9 SASI_Hs02_00378154 predicted 578
10 SASI_Hs02_00378155 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106332 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217928 predicted 1141
2 SASI_Rn02_00217929 predicted 1270
3 SASI_Rn02_00217930 predicted 1250
4 SASI_Rn02_00217931 predicted 1188
5 SASI_Rn02_00217932 predicted 1199
6 SASI_Rn02_00217933 predicted 1195
7 SASI_Rn02_00217934 predicted 1203
8 SASI_Rn02_00217935 predicted 510
9 SASI_Rn02_00217936 predicted 1191
10 SASI_Rn02_00217937 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339416 predicted 645
2 SASI_Mm01_00079572 predicted 521
3 SASI_Mm01_00079573 predicted 1289
4 SASI_Mm01_00079574 predicted 421
5 SASI_Mm01_00079575 predicted 1303
6 SASI_Mm01_00079576 predicted 486
7 SASI_Mm01_00079578 predicted 229
8 SASI_Mm01_00079579 predicted 1281
9 SASI_Mm01_00079580 predicted 217
10 SASI_Mm01_00079581 predicted 348
11 SASI_Mm01_00079577 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017670
VALIDATED
OTUB1 MISSION shRNA Bacterial Glycerol Stock
OTU domain, ubiquitin aldehyde binding 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-220s1c1
Sequence:CCGGAGGAGTATGCTGAAGATGACACTCGAGTGTCATCTTCAGCATACTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-931s1c1
Sequence:CCGGTGTGGTTGTAAATGGTCCTATCTCGAGATAGGACCATTTACAACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-315s1c1
Sequence:CCGGTGTTTCTATCGGGCTTTCGGACTCGAGTCCGAAAGCCCGATAGAAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-770s1c1
Sequence:CCGGCACCACCAATCCGCACATCTTCTCGAGAAGATGTGCGGATTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-650s21c1
Sequence:CCGGAGCGACTCCGAAGGTGTTAACCTCGAGGTTAACACCTTCGGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-1248s21c1
Sequence:CCGGGCGACCACATCCACATCATTGCTCGAGCAATGATGTGGATGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-780s21c1
Sequence:CCGGAGGAGTATGCTGAAGATGACACTCGAGTGTCATCTTCAGCATACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017670.2-1491s21c1
Sequence:CCGGTGTGGTTGTAAATGGTCCTATCTCGAGATAGGACCATTTACAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-1330s21c1
Sequence:CCGGCACCACCAATCCGCACATCTTCTCGAGAAGATGTGCGGATTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017670
VALIDATED
OTUB1 MISSION shRNA shRNA Plasmid DNA
OTU domain, ubiquitin aldehyde binding 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-220s1c1
Sequence:CCGGAGGAGTATGCTGAAGATGACACTCGAGTGTCATCTTCAGCATACTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-931s1c1
Sequence:CCGGTGTGGTTGTAAATGGTCCTATCTCGAGATAGGACCATTTACAACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-315s1c1
Sequence:CCGGTGTTTCTATCGGGCTTTCGGACTCGAGTCCGAAAGCCCGATAGAAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-770s1c1
Sequence:CCGGCACCACCAATCCGCACATCTTCTCGAGAAGATGTGCGGATTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-650s21c1
Sequence:CCGGAGCGACTCCGAAGGTGTTAACCTCGAGGTTAACACCTTCGGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-1248s21c1
Sequence:CCGGGCGACCACATCCACATCATTGCTCGAGCAATGATGTGGATGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-780s21c1
Sequence:CCGGAGGAGTATGCTGAAGATGACACTCGAGTGTCATCTTCAGCATACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017670.2-1491s21c1
Sequence:CCGGTGTGGTTGTAAATGGTCCTATCTCGAGATAGGACCATTTACAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-1330s21c1
Sequence:CCGGCACCACCAATCCGCACATCTTCTCGAGAAGATGTGCGGATTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017670
VALIDATED
OTUB1 MISSION shRNA Lentiviral Transduction Particles
OTU domain, ubiquitin aldehyde binding 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-220s1c1
Sequence:CCGGAGGAGTATGCTGAAGATGACACTCGAGTGTCATCTTCAGCATACTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-931s1c1
Sequence:CCGGTGTGGTTGTAAATGGTCCTATCTCGAGATAGGACCATTTACAACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-315s1c1
Sequence:CCGGTGTTTCTATCGGGCTTTCGGACTCGAGTCCGAAAGCCCGATAGAAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_017670.x-770s1c1
Sequence:CCGGCACCACCAATCCGCACATCTTCTCGAGAAGATGTGCGGATTGGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-650s21c1
Sequence:CCGGAGCGACTCCGAAGGTGTTAACCTCGAGGTTAACACCTTCGGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-1248s21c1
Sequence:CCGGGCGACCACATCCACATCATTGCTCGAGCAATGATGTGGATGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-780s21c1
Sequence:CCGGAGGAGTATGCTGAAGATGACACTCGAGTGTCATCTTCAGCATACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017670.2-1491s21c1
Sequence:CCGGTGTGGTTGTAAATGGTCCTATCTCGAGATAGGACCATTTACAACCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_017670.2-1330s21c1
Sequence:CCGGCACCACCAATCCGCACATCTTCTCGAGAAGATGTGCGGATTGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134150
VALIDATED
OTUB1 MISSION shRNA Bacterial Glycerol Stock
OTU domain, ubiquitin aldehyde binding 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134150.1-1292s1c1
Sequence:CCGGGCCACCCATACAAAGCACTTACTCGAGTAAGTGCTTTGTATGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-712s1c1
Sequence:CCGGGTCCATCCAAGTGGAGTACATCTCGAGATGTACTCCACTTGGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-583s1c1
Sequence:CCGGGAGCAAGTTCTTCGAGCACTTCTCGAGAAGTGCTCGAAGAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-139s1c1
Sequence:CCGGGCAAGAGATTGCTGTGCAGAACTCGAGTTCTGCACAGCAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134150.1-96s1c1
Sequence:CCGGTGGCCTATGATGAAGCCATTACTCGAGTAATGGCTTCATCATAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-808s21c1
Sequence:CCGGCCGACCTGGACACTACGATATCTCGAGATATCGTAGTGTCCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-955s21c1
Sequence:CCGGTGGTTGTAAATGGTCATATTTCTCGAGAAATATGACCATTTACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-712s21c1
Sequence:CCGGGTCCATCCAAGTGGAGTACATCTCGAGATGTACTCCACTTGGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-71s21c1
Sequence:CCGGAGCGACTCCGAAGGTGTTAACCTCGAGGTTAACACCTTCGGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-583s21c1
Sequence:CCGGGAGCAAGTTCTTCGAGCACTTCTCGAGAAGTGCTCGAAGAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-139s21c1
Sequence:CCGGGCAAGAGATTGCTGTGCAGAACTCGAGTTCTGCACAGCAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134150
VALIDATED
OTUB1 MISSION shRNA shRNA Plasmid DNA
OTU domain, ubiquitin aldehyde binding 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134150.1-1292s1c1
Sequence:CCGGGCCACCCATACAAAGCACTTACTCGAGTAAGTGCTTTGTATGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-712s1c1
Sequence:CCGGGTCCATCCAAGTGGAGTACATCTCGAGATGTACTCCACTTGGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-583s1c1
Sequence:CCGGGAGCAAGTTCTTCGAGCACTTCTCGAGAAGTGCTCGAAGAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-139s1c1
Sequence:CCGGGCAAGAGATTGCTGTGCAGAACTCGAGTTCTGCACAGCAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134150.1-96s1c1
Sequence:CCGGTGGCCTATGATGAAGCCATTACTCGAGTAATGGCTTCATCATAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-808s21c1
Sequence:CCGGCCGACCTGGACACTACGATATCTCGAGATATCGTAGTGTCCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-955s21c1
Sequence:CCGGTGGTTGTAAATGGTCATATTTCTCGAGAAATATGACCATTTACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-712s21c1
Sequence:CCGGGTCCATCCAAGTGGAGTACATCTCGAGATGTACTCCACTTGGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-71s21c1
Sequence:CCGGAGCGACTCCGAAGGTGTTAACCTCGAGGTTAACACCTTCGGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-583s21c1
Sequence:CCGGGAGCAAGTTCTTCGAGCACTTCTCGAGAAGTGCTCGAAGAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-139s21c1
Sequence:CCGGGCAAGAGATTGCTGTGCAGAACTCGAGTTCTGCACAGCAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134150
VALIDATED
OTUB1 MISSION shRNA Lentiviral Transduction Particles
OTU domain, ubiquitin aldehyde binding 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134150.1-1292s1c1
Sequence:CCGGGCCACCCATACAAAGCACTTACTCGAGTAAGTGCTTTGTATGGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-712s1c1
Sequence:CCGGGTCCATCCAAGTGGAGTACATCTCGAGATGTACTCCACTTGGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-583s1c1
Sequence:CCGGGAGCAAGTTCTTCGAGCACTTCTCGAGAAGTGCTCGAAGAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134150.1-139s1c1
Sequence:CCGGGCAAGAGATTGCTGTGCAGAACTCGAGTTCTGCACAGCAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134150.1-96s1c1
Sequence:CCGGTGGCCTATGATGAAGCCATTACTCGAGTAATGGCTTCATCATAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-808s21c1
Sequence:CCGGCCGACCTGGACACTACGATATCTCGAGATATCGTAGTGTCCAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-955s21c1
Sequence:CCGGTGGTTGTAAATGGTCATATTTCTCGAGAAATATGACCATTTACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-712s21c1
Sequence:CCGGGTCCATCCAAGTGGAGTACATCTCGAGATGTACTCCACTTGGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-71s21c1
Sequence:CCGGAGCGACTCCGAAGGTGTTAACCTCGAGGTTAACACCTTCGGAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134150.2-583s21c1
Sequence:CCGGGAGCAAGTTCTTCGAGCACTTCTCGAGAAGTGCTCGAAGAACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134150.2-139s21c1
Sequence:CCGGGCAAGAGATTGCTGTGCAGAACTCGAGTTCTGCACAGCAATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks