EMAIL THIS PAGE TO A FRIEND

OTUD7A

OTU domain containing 7A

Synonyms: C15orf16 C16ORF15 CEZANNE2 OTUD7
UniProtKB ID: Q8TE49, Q8IWK5
Gene ID:
Human(161725) Summary: Deubiquitinating enzymes (DUBs; see MIM 603478) are proteases that specifically cleave ubiquitin (MIM 191339) linkages, negating the action of ubiquitin ligases. OTUD7A belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain.[supplied by OMIM, May 2008]
Mouse(170711) OTU domain containing 7A
Rat(309252) OTU domain containing 7A
chicken(415380) OTU domain containing 7A
cow(789946) OTU domain containing 7A
domestic cat(101086908) OTU domain containing 7A
Horse(100060048) OTU domain containing 7A
dog(488697) OTU domain containing 7A
naked mole-rat(101720899) OTU domain containing 7A
Domestic Rabbit(100344090) OTU domain containing 7A
domestic guinea pig(100720085) OTU domain containing 7A
sheep(101120609) OTU domain containing 7A
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130901 Rosetta Predictions human pricing
XM_001058176 Rosetta Predictions rat pricing
XM_219703 Rosetta Predictions rat pricing
NM_130880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055782 predicted 1020
2 SASI_Hs01_00055783 predicted 599
3 SASI_Hs01_00055784 predicted 1036
4 SASI_Hs01_00055785 predicted 300
5 SASI_Hs01_00055786 predicted 298
6 SASI_Hs01_00055787 predicted 1161
7 SASI_Hs01_00055788 predicted 656
8 SASI_Hs01_00055789 predicted 624
9 SASI_Hs01_00055790 predicted 298
10 SASI_Hs01_00055791 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288857 predicted 2283
2 SASI_Rn02_00288858 predicted 2172
3 SASI_Rn02_00288859 predicted 2005
4 SASI_Rn02_00288860 predicted 1755
5 SASI_Rn02_00288861 predicted 1531
6 SASI_Rn02_00288862 predicted 460
7 SASI_Rn02_00288863 predicted 474
8 SASI_Rn02_00288864 predicted 1024
9 SASI_Rn02_00288865 predicted 923
10 SASI_Rn02_00288866 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378589 predicted 1571
2 SASI_Rn02_00378590 predicted 2028
3 SASI_Rn02_00378591 predicted 1774
4 SASI_Rn02_00378592 predicted 1194
5 SASI_Rn02_00378593 predicted 1866
6 SASI_Rn02_00378594 predicted 1774
7 SASI_Rn02_00378595 predicted 1553
8 SASI_Rn02_00378596 predicted 1437
9 SASI_Rn02_00378597 predicted 2043
10 SASI_Rn02_00378598 predicted 1931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091108 predicted 1636
2 SASI_Mm01_00091109 predicted 1930
3 SASI_Mm01_00091110 predicted 2272
4 SASI_Mm01_00091111 predicted 1540
5 SASI_Mm01_00091112 predicted 2237
6 SASI_Mm01_00091113 predicted 1853
7 SASI_Mm01_00091114 predicted 1263
8 SASI_Mm01_00091115 predicted 1683
9 SASI_Mm01_00091116 predicted 1015
10 SASI_Mm01_00091117 predicted 2225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130901
OTUD7A MISSION shRNA Bacterial Glycerol Stock
OTU domain containing 7A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130901.1-673s21c1
Sequence:CCGGACGAGCTGTAAACGGCTTCTTCTCGAGAAGAAGCCGTTTACAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130901.1-526s21c1
Sequence:CCGGGAGATGCCAATCTACACATTCCTCGAGGAATGTGTAGATTGGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-1046s1c1
Sequence:CCGGCCATCGTTGTTGTGGCAGATACTCGAGTATCTGCCACAACAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-1538s1c1
Sequence:CCGGGCAGCAATTCTAACAGCAATACTCGAGTATTGCTGTTAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-2766s1c1
Sequence:CCGGGCGCGAGAACTGTGCGTTCTACTCGAGTAGAACGCACAGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-928s1c1
Sequence:CCGGCGCACACACTTCAGCAAGAATCTCGAGATTCTTGCTGAAGTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-573s1c1
Sequence:CCGGCGAGGATTTCAGGAGCTTCATCTCGAGATGAAGCTCCTGAAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130901
OTUD7A MISSION shRNA shRNA Plasmid DNA
OTU domain containing 7A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130901.1-673s21c1
Sequence:CCGGACGAGCTGTAAACGGCTTCTTCTCGAGAAGAAGCCGTTTACAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130901.1-526s21c1
Sequence:CCGGGAGATGCCAATCTACACATTCCTCGAGGAATGTGTAGATTGGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-1046s1c1
Sequence:CCGGCCATCGTTGTTGTGGCAGATACTCGAGTATCTGCCACAACAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-1538s1c1
Sequence:CCGGGCAGCAATTCTAACAGCAATACTCGAGTATTGCTGTTAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-2766s1c1
Sequence:CCGGGCGCGAGAACTGTGCGTTCTACTCGAGTAGAACGCACAGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-928s1c1
Sequence:CCGGCGCACACACTTCAGCAAGAATCTCGAGATTCTTGCTGAAGTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-573s1c1
Sequence:CCGGCGAGGATTTCAGGAGCTTCATCTCGAGATGAAGCTCCTGAAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130901
OTUD7A MISSION shRNA Lentiviral Transduction Particles
OTU domain containing 7A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130901.1-673s21c1
Sequence:CCGGACGAGCTGTAAACGGCTTCTTCTCGAGAAGAAGCCGTTTACAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130901.1-526s21c1
Sequence:CCGGGAGATGCCAATCTACACATTCCTCGAGGAATGTGTAGATTGGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-1046s1c1
Sequence:CCGGCCATCGTTGTTGTGGCAGATACTCGAGTATCTGCCACAACAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-1538s1c1
Sequence:CCGGGCAGCAATTCTAACAGCAATACTCGAGTATTGCTGTTAGAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-2766s1c1
Sequence:CCGGGCGCGAGAACTGTGCGTTCTACTCGAGTAGAACGCACAGTTCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-928s1c1
Sequence:CCGGCGCACACACTTCAGCAAGAATCTCGAGATTCTTGCTGAAGTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130901.1-573s1c1
Sequence:CCGGCGAGGATTTCAGGAGCTTCATCTCGAGATGAAGCTCCTGAAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130880
OTUD7A MISSION shRNA Bacterial Glycerol Stock
OTU domain containing 7A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1477s1c1
Sequence:CCGGGCCTACGATCAAGCTCACTTTCTCGAGAAAGTGAGCTTGATCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1285s1c1
Sequence:CCGGCCTGTATATGAAAGCCTGGAACTCGAGTTCCAGGCTTTCATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-786s1c1
Sequence:CCGGCGTGGCAAATGAGTGCAACAACTCGAGTTGTTGCACTCATTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1962s1c1
Sequence:CCGGGCTGGGCATCAAGCTAAAGAACTCGAGTTCTTTAGCTTGATGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-3096s1c1
Sequence:CCGGGCACTTCTGCTCCTATTGCTACTCGAGTAGCAATAGGAGCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130880
OTUD7A MISSION shRNA shRNA Plasmid DNA
OTU domain containing 7A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1477s1c1
Sequence:CCGGGCCTACGATCAAGCTCACTTTCTCGAGAAAGTGAGCTTGATCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1285s1c1
Sequence:CCGGCCTGTATATGAAAGCCTGGAACTCGAGTTCCAGGCTTTCATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-786s1c1
Sequence:CCGGCGTGGCAAATGAGTGCAACAACTCGAGTTGTTGCACTCATTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1962s1c1
Sequence:CCGGGCTGGGCATCAAGCTAAAGAACTCGAGTTCTTTAGCTTGATGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-3096s1c1
Sequence:CCGGGCACTTCTGCTCCTATTGCTACTCGAGTAGCAATAGGAGCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130880
OTUD7A MISSION shRNA Lentiviral Transduction Particles
OTU domain containing 7A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1477s1c1
Sequence:CCGGGCCTACGATCAAGCTCACTTTCTCGAGAAAGTGAGCTTGATCGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1285s1c1
Sequence:CCGGCCTGTATATGAAAGCCTGGAACTCGAGTTCCAGGCTTTCATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-786s1c1
Sequence:CCGGCGTGGCAAATGAGTGCAACAACTCGAGTTGTTGCACTCATTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-1962s1c1
Sequence:CCGGGCTGGGCATCAAGCTAAAGAACTCGAGTTCTTTAGCTTGATGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130880.1-3096s1c1
Sequence:CCGGGCACTTCTGCTCCTATTGCTACTCGAGTAGCAATAGGAGCAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks