EMAIL THIS PAGE TO A FRIEND

OTUD7B

OTU domain containing 7B

Synonyms: CEZANNE ZA20D1
Gene ID:
Mouse(229603) OTU domain containing 7B
Rat(310677) OTU domain containing 7B
sheep(101116276) OTU domain containing 7B
domestic guinea pig(100719181) OTU domain containing 7B
naked mole-rat(101713492) OTU domain containing 7B
Zebrafish(777637) OTU domain containing 7B
chicken(426041) OTU domain containing 7B
cow(525579) OTU domain containing 7B
Horse(100054396) OTU domain containing 7B
domestic cat(101089203) OTU domain containing 7B
dog(483178) OTU domain containing 7B
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020205 Rosetta Predictions human pricing
NM_001107697 Rosetta Predictions rat pricing
NM_001025613 Rosetta Predictions mouse pricing
NM_001025614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089029 predicted 2926
2 SASI_Hs01_00089030 predicted 1135
3 SASI_Hs01_00089031 predicted 1022
4 SASI_Hs01_00089032 predicted 1471
5 SASI_Hs01_00089033 predicted 1410
6 SASI_Hs02_00353142 predicted 1349
7 SASI_Hs01_00089034 predicted 1248
8 SASI_Hs01_00089035 predicted 1479
9 SASI_Hs01_00089036 predicted 1485
10 SASI_Hs01_00089037 predicted 1212
11 SASI_Hs01_00089038 predicted 2586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231385 predicted 1348
2 SASI_Rn02_00231386 predicted 2311
3 SASI_Rn02_00231387 predicted 994
4 SASI_Rn02_00231388 predicted 1474
5 SASI_Rn02_00231389 predicted 2107
6 SASI_Rn02_00231390 predicted 2871
7 SASI_Rn02_00231391 predicted 511
8 SASI_Rn02_00231392 predicted 438
9 SASI_Rn02_00231393 predicted 2901
10 SASI_Rn02_00231394 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287980 predicted 2371
2 SASI_Mm02_00287981 predicted 665
3 SASI_Mm02_00287982 predicted 1219
4 SASI_Mm02_00287983 predicted 2201
5 SASI_Mm02_00287984 predicted 2854
6 SASI_Mm02_00287985 predicted 573
7 SASI_Mm02_00287986 predicted 1920
8 SASI_Mm02_00287987 predicted 2175
9 SASI_Mm02_00287988 predicted 1468
10 SASI_Mm02_00287989 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287990 predicted 2306
2 SASI_Mm02_00287991 predicted 611
3 SASI_Mm02_00287992 predicted 1164
4 SASI_Mm02_00287993 predicted 2142
5 SASI_Mm02_00287994 predicted 2794
6 SASI_Mm02_00287995 predicted 521
7 SASI_Mm02_00287996 predicted 1857
8 SASI_Mm02_00287997 predicted 2110
9 SASI_Mm02_00287998 predicted 1414
10 SASI_Mm02_00287999 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020205
VALIDATED
OTUD7B MISSION shRNA Bacterial Glycerol Stock
OTU domain containing 7B
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020205.x-530s1c1
Sequence:CCGGCGGTCCCATGTCTCCTCCAATCTCGAGATTGGAGGAGACATGGGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020205.x-1064s1c1
Sequence:CCGGCCTGTATATGAGAGCCTTGAACTCGAGTTCAAGGCTCTCATATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020205.x-2751s1c1
Sequence:CCGGGCAAGGAGGCTAAACAAAGTTCTCGAGAACTTTGTTTAGCCTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020205.x-2587s1c1
Sequence:CCGGCCCAACTCAGACCAAATGCAACTCGAGTTGCATTTGGTCTGAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1209s21c1
Sequence:CCGGAGTTCTGAGGAGCCTGTATATCTCGAGATATACAGGCTCCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1237s21c1
Sequence:GTACCGGTTGAAGAGTTTCACGTCTTTGCTCGAGCAAAGACGTGAAACTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1852s21c1
Sequence:CCGGCAGATTCTGTGGCTAACAAACCTCGAGGTTTGTTAGCCACAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1601s21c1
Sequence:CCGGTCTGTCCCTAGAGGTCAAATTCTCGAGAATTTGACCTCTAGGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-4689s21c1
Sequence:CCGGTGGAAATGCTCACGGTTTATACTCGAGTATAAACCGTGAGCATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2102s21c1
Sequence:CCGGTAACGGAGGGAGCAAGTATAGCTCGAGCTATACTTGCTCCCTCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2922s21c1
Sequence:CCGGCAAAGTTAAGCTCAACTAATTCTCGAGAATTAGTTGAGCTTAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2662s21c1
Sequence:CCGGACCGAGTGGCTGATTCCTATACTCGAGTATAGGAATCAGCCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020205
VALIDATED
OTUD7B MISSION shRNA shRNA Plasmid DNA
OTU domain containing 7B
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020205.x-530s1c1
Sequence:CCGGCGGTCCCATGTCTCCTCCAATCTCGAGATTGGAGGAGACATGGGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020205.x-1064s1c1
Sequence:CCGGCCTGTATATGAGAGCCTTGAACTCGAGTTCAAGGCTCTCATATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020205.x-2751s1c1
Sequence:CCGGGCAAGGAGGCTAAACAAAGTTCTCGAGAACTTTGTTTAGCCTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020205.x-2587s1c1
Sequence:CCGGCCCAACTCAGACCAAATGCAACTCGAGTTGCATTTGGTCTGAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1209s21c1
Sequence:CCGGAGTTCTGAGGAGCCTGTATATCTCGAGATATACAGGCTCCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1237s21c1
Sequence:GTACCGGTTGAAGAGTTTCACGTCTTTGCTCGAGCAAAGACGTGAAACTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1852s21c1
Sequence:CCGGCAGATTCTGTGGCTAACAAACCTCGAGGTTTGTTAGCCACAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1601s21c1
Sequence:CCGGTCTGTCCCTAGAGGTCAAATTCTCGAGAATTTGACCTCTAGGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-4689s21c1
Sequence:CCGGTGGAAATGCTCACGGTTTATACTCGAGTATAAACCGTGAGCATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2102s21c1
Sequence:CCGGTAACGGAGGGAGCAAGTATAGCTCGAGCTATACTTGCTCCCTCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2922s21c1
Sequence:CCGGCAAAGTTAAGCTCAACTAATTCTCGAGAATTAGTTGAGCTTAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2662s21c1
Sequence:CCGGACCGAGTGGCTGATTCCTATACTCGAGTATAGGAATCAGCCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020205
VALIDATED
OTUD7B MISSION shRNA Lentiviral Transduction Particles
OTU domain containing 7B
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020205.x-530s1c1
Sequence:CCGGCGGTCCCATGTCTCCTCCAATCTCGAGATTGGAGGAGACATGGGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020205.x-1064s1c1
Sequence:CCGGCCTGTATATGAGAGCCTTGAACTCGAGTTCAAGGCTCTCATATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020205.x-2751s1c1
Sequence:CCGGGCAAGGAGGCTAAACAAAGTTCTCGAGAACTTTGTTTAGCCTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020205.x-2587s1c1
Sequence:CCGGCCCAACTCAGACCAAATGCAACTCGAGTTGCATTTGGTCTGAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1209s21c1
Sequence:CCGGAGTTCTGAGGAGCCTGTATATCTCGAGATATACAGGCTCCTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1237s21c1
Sequence:GTACCGGTTGAAGAGTTTCACGTCTTTGCTCGAGCAAAGACGTGAAACTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1852s21c1
Sequence:CCGGCAGATTCTGTGGCTAACAAACCTCGAGGTTTGTTAGCCACAGAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-1601s21c1
Sequence:CCGGTCTGTCCCTAGAGGTCAAATTCTCGAGAATTTGACCTCTAGGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-4689s21c1
Sequence:CCGGTGGAAATGCTCACGGTTTATACTCGAGTATAAACCGTGAGCATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2102s21c1
Sequence:CCGGTAACGGAGGGAGCAAGTATAGCTCGAGCTATACTTGCTCCCTCCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2922s21c1
Sequence:CCGGCAAAGTTAAGCTCAACTAATTCTCGAGAATTAGTTGAGCTTAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020205.2-2662s21c1
Sequence:CCGGACCGAGTGGCTGATTCCTATACTCGAGTATAGGAATCAGCCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025614
VALIDATED
OTUD7B MISSION shRNA Bacterial Glycerol Stock
OTU domain containing 7B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-1121s21c1
Sequence:CCGGGCAGAAGGAATGGAATGAATTCTCGAGAATTCATTCCATTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025614.1-867s21c1
Sequence:CCGGCTGAATTGGTGGGTTAGTATGCTCGAGCATACTAACCCACCAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025614.1-1583s21c1
Sequence:CCGGTGTCCGATTGGCCAGTATAATCTCGAGATTATACTGGCCAATCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-523s21c1
Sequence:CCGGCCTTTAGTGGAGGGAGTACTTCTCGAGAAGTACTCCCTCCACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-3347s21c1
Sequence:CCGGGGTAGATATTAGGGTTGAATACTCGAGTATTCAACCCTAATATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025614
VALIDATED
OTUD7B MISSION shRNA shRNA Plasmid DNA
OTU domain containing 7B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-1121s21c1
Sequence:CCGGGCAGAAGGAATGGAATGAATTCTCGAGAATTCATTCCATTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025614.1-867s21c1
Sequence:CCGGCTGAATTGGTGGGTTAGTATGCTCGAGCATACTAACCCACCAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025614.1-1583s21c1
Sequence:CCGGTGTCCGATTGGCCAGTATAATCTCGAGATTATACTGGCCAATCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-523s21c1
Sequence:CCGGCCTTTAGTGGAGGGAGTACTTCTCGAGAAGTACTCCCTCCACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-3347s21c1
Sequence:CCGGGGTAGATATTAGGGTTGAATACTCGAGTATTCAACCCTAATATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025614
VALIDATED
OTUD7B MISSION shRNA Lentiviral Transduction Particles
OTU domain containing 7B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-1121s21c1
Sequence:CCGGGCAGAAGGAATGGAATGAATTCTCGAGAATTCATTCCATTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025614.1-867s21c1
Sequence:CCGGCTGAATTGGTGGGTTAGTATGCTCGAGCATACTAACCCACCAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025614.1-1583s21c1
Sequence:CCGGTGTCCGATTGGCCAGTATAATCTCGAGATTATACTGGCCAATCGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-523s21c1
Sequence:CCGGCCTTTAGTGGAGGGAGTACTTCTCGAGAAGTACTCCCTCCACTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025614.1-3347s21c1
Sequence:CCGGGGTAGATATTAGGGTTGAATACTCGAGTATTCAACCCTAATATCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks