EMAIL THIS PAGE TO A FRIEND

OTX2

orthodenticle homeobox 2

Synonyms: CPHD6 MCOPS5
UniProtKB ID: P32243, B2RAN5, Q6GTV3, Q9HAW3, Q9P2R1
Gene ID:
Human(5015) Summary: This gene encodes a member of the bicoid subfamily of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and plays a role in brain, craniofacial, and sensory organ development. The encoded protein also influences the proliferation and differentiation of dopaminergic neuronal progenitor cells during mitosis. Mutations in this gene cause syndromic microphthalmia 5 (MCOPS5) and combined pituitary hormone deficiency 6 (CPHD6). This gene is also suspected of having an oncogenic role in medulloblastoma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Pseudogenes of this gene are known to exist on chromosomes two and nine. [provided by RefSeq, Jul 2012]
Mouse(18424) orthodenticle homolog 2 (Drosophila)
Rat(305858) orthodenticle homeobox 2
Zebrafish(30501) orthodenticle homolog 2
cow(538953) orthodenticle homeobox 2
domestic cat(101094107) orthodenticle homeobox 2
chicken(395191) orthodenticle homeobox 2
dog(490708) orthodenticle homeobox 2
sheep(101114527) orthodenticle homeobox 2
domestic guinea pig(100729098) orthodenticle homeobox 2
naked mole-rat(101696878) orthodenticle homeobox 2
Domestic Rabbit(100009374) orthodenticle homeobox 2
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101697 Anti-OTX2 (ab2) antibody produced in rabbit affinity isolated antibody rat, rabbit, guinea pig, canine, rabbit, sheep, bovine, horse, human, mouse
western blot pricing
SAB2101698 Anti-OTX2 (ab3) antibody produced in rabbit affinity isolated antibody human, zebrafish, guinea pig, rabbit, bovine, rat, horse, sheep, rabbit, canine, mouse
western blot pricing
SAB2701656 Anti-otx2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2108193 Anti-OTX2 antibody produced in rabbit affinity isolated antibody zebrafish, horse, rabbit, rat, guinea pig, canine, mouse, human, bovine, rabbit
western blot pricing
HPA000633 Anti-OTX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV32439 Anti-OTX2 antibody produced in rabbit affinity isolated antibody canine, sheep, horse, rabbit, rat, mouse, guinea pig, rabbit, zebrafish, bovine, human
immunohistochemistry, western blot pricing
SAB5300043 Monoclonal Anti-OTX2 antibody produced in mouse clone 1H12C4B5, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300044 Monoclonal Anti-OTX2 antibody produced in mouse clone 1H12G8B2, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021728 Rosetta Predictions human pricing
NM_172337 Rosetta Predictions human pricing
XM_001057814 Rosetta Predictions rat pricing
XM_001073859 Rosetta Predictions rat pricing
XM_224009 Rosetta Predictions rat pricing
NM_144841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054912 predicted 1131
2 SASI_Hs01_00054914 predicted 635
3 SASI_Hs01_00054915 predicted 1049
4 SASI_Hs01_00054916 predicted 1363
5 SASI_Hs01_00054917 predicted 1326
6 SASI_Hs01_00054918 predicted 671
7 SASI_Hs02_00355045 predicted 1420
8 SASI_Hs02_00355046 predicted 1060
9 SASI_Hs01_00054920 predicted 815
10 SASI_Hs01_00054921 predicted 855
11 SASI_Hs01_00054913 predicted 1260
12 SASI_Hs01_00054919 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242990 predicted 1001
2 SASI_Hs01_00242992 predicted 507
3 SASI_Hs01_00242993 predicted 923
4 SASI_Hs01_00242994 predicted 1237
5 SASI_Hs01_00242995 predicted 1196
6 SASI_Hs01_00242996 predicted 540
7 SASI_Hs01_00242997 predicted 1272
8 SASI_Hs02_00367985 predicted 1301
9 SASI_Hs01_00242998 predicted 689
10 SASI_Hs01_00242999 predicted 730
11 SASI_Hs01_00242991 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287646 predicted 782
2 SASI_Rn02_00287647 predicted 488
3 SASI_Rn02_00287648 predicted 619
4 SASI_Rn02_00287649 predicted 491
5 SASI_Rn02_00287650 predicted 314
6 SASI_Rn02_00287651 predicted 1319
7 SASI_Rn02_00287652 predicted 423
8 SASI_Rn02_00287653 predicted 791
9 SASI_Rn02_00287654 predicted 746
10 SASI_Rn02_00287655 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344237 predicted 961
2 SASI_Rn02_00344238 predicted 667
3 SASI_Rn02_00344239 predicted 800
4 SASI_Rn02_00344240 predicted 671
5 SASI_Rn02_00344241 predicted 484
6 SASI_Rn02_00344242 predicted 1490
7 SASI_Rn02_00344243 predicted 597
8 SASI_Rn02_00344244 predicted 962
9 SASI_Rn02_00344245 predicted 931
10 SASI_Rn02_00344246 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381789 predicted 918
2 SASI_Rn02_00381790 predicted 627
3 SASI_Rn02_00381791 predicted 765
4 SASI_Rn02_00381792 predicted 632
5 SASI_Rn02_00381793 predicted 447
6 SASI_Rn02_00381794 predicted 1455
7 SASI_Rn02_00381795 predicted 559
8 SASI_Rn02_00381796 predicted 929
9 SASI_Rn02_00381797 predicted 895
10 SASI_Rn02_00381798 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114724 predicted 1367
2 SASI_Mm01_00114725 predicted 519
3 SASI_Mm01_00114726 predicted 355
4 SASI_Mm01_00114727 predicted 1083
5 SASI_Mm01_00114729 predicted 1354
6 SASI_Mm01_00114730 predicted 1411
7 SASI_Mm01_00114731 predicted 1476
8 SASI_Mm01_00114732 predicted 701
9 SASI_Mm01_00114733 predicted 1164
10 SASI_Mm02_00340231 predicted 562
11 SASI_Mm01_00114728 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144841
OTX2 MISSION shRNA Bacterial Glycerol Stock
orthodenticle homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-925s1c1
Sequence:CCGGGCATGGACTGTGGATCTTATTCTCGAGAATAAGATCCACAGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-1090s1c1
Sequence:CCGGCCACTGATTGCTTGGATTATACTCGAGTATAATCCAAGCAATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-1146s1c1
Sequence:CCGGGCTGACTGCTTGGATTATAAACTCGAGTTTATAATCCAAGCAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144841.1-1441s1c1
Sequence:CCGGCCTGATTTGCAAATGATTGATCTCGAGATCAATCATTTGCAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144841.3-484s21c1
Sequence:CCGGACGTTCTGGAAGCTCTGTTTGCTCGAGCAAACAGAGCTTCCAGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1307s21c1
Sequence:CCGGCAGACTCCTGATCAAAGTTACCTCGAGGTAACTTTGATCAGGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1471s21c1
Sequence:CCGGTCTAGCGACATGCAACCAAATCTCGAGATTTGGTTGCATGTCGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1370s21c1
Sequence:CCGGCATCAACCAGCAACCTGAAATCTCGAGATTTCAGGTTGCTGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144841
OTX2 MISSION shRNA shRNA Plasmid DNA
orthodenticle homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-925s1c1
Sequence:CCGGGCATGGACTGTGGATCTTATTCTCGAGAATAAGATCCACAGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-1090s1c1
Sequence:CCGGCCACTGATTGCTTGGATTATACTCGAGTATAATCCAAGCAATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-1146s1c1
Sequence:CCGGGCTGACTGCTTGGATTATAAACTCGAGTTTATAATCCAAGCAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144841.1-1441s1c1
Sequence:CCGGCCTGATTTGCAAATGATTGATCTCGAGATCAATCATTTGCAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144841.3-484s21c1
Sequence:CCGGACGTTCTGGAAGCTCTGTTTGCTCGAGCAAACAGAGCTTCCAGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1307s21c1
Sequence:CCGGCAGACTCCTGATCAAAGTTACCTCGAGGTAACTTTGATCAGGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1471s21c1
Sequence:CCGGTCTAGCGACATGCAACCAAATCTCGAGATTTGGTTGCATGTCGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1370s21c1
Sequence:CCGGCATCAACCAGCAACCTGAAATCTCGAGATTTCAGGTTGCTGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144841
OTX2 MISSION shRNA Lentiviral Transduction Particles
orthodenticle homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-925s1c1
Sequence:CCGGGCATGGACTGTGGATCTTATTCTCGAGAATAAGATCCACAGTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-1090s1c1
Sequence:CCGGCCACTGATTGCTTGGATTATACTCGAGTATAATCCAAGCAATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144841.1-1146s1c1
Sequence:CCGGGCTGACTGCTTGGATTATAAACTCGAGTTTATAATCCAAGCAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144841.1-1441s1c1
Sequence:CCGGCCTGATTTGCAAATGATTGATCTCGAGATCAATCATTTGCAAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144841.3-484s21c1
Sequence:CCGGACGTTCTGGAAGCTCTGTTTGCTCGAGCAAACAGAGCTTCCAGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1307s21c1
Sequence:CCGGCAGACTCCTGATCAAAGTTACCTCGAGGTAACTTTGATCAGGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1471s21c1
Sequence:CCGGTCTAGCGACATGCAACCAAATCTCGAGATTTGGTTGCATGTCGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144841.3-1370s21c1
Sequence:CCGGCATCAACCAGCAACCTGAAATCTCGAGATTTCAGGTTGCTGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021728
OTX2 MISSION shRNA Bacterial Glycerol Stock
orthodenticle homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021728.2-1932s1c1
Sequence:CCGGGCACTGAAACTTTACGACAAACTCGAGTTTGTCGTAAAGTTTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021728.2-1143s1c1
Sequence:CCGGCCTCGTGGAAATTCCAGGTTTCTCGAGAAACCTGGAATTTCCACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021728.2-825s1c1
Sequence:CCGGCCATGACCTATACTCAGGCTTCTCGAGAAGCCTGAGTATAGGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021728.2-1393s21c1
Sequence:CCGGGATCATTGGTTATCCTGATTTCTCGAGAAATCAGGATAACCAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021728.2-1542s21c1
Sequence:CCGGTAGCCAATCCTTGGTTGAATCCTCGAGGATTCAACCAAGGATTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021728
OTX2 MISSION shRNA shRNA Plasmid DNA
orthodenticle homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021728.2-1932s1c1
Sequence:CCGGGCACTGAAACTTTACGACAAACTCGAGTTTGTCGTAAAGTTTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021728.2-1143s1c1
Sequence:CCGGCCTCGTGGAAATTCCAGGTTTCTCGAGAAACCTGGAATTTCCACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021728.2-825s1c1
Sequence:CCGGCCATGACCTATACTCAGGCTTCTCGAGAAGCCTGAGTATAGGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021728.2-1393s21c1
Sequence:CCGGGATCATTGGTTATCCTGATTTCTCGAGAAATCAGGATAACCAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021728.2-1542s21c1
Sequence:CCGGTAGCCAATCCTTGGTTGAATCCTCGAGGATTCAACCAAGGATTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021728
OTX2 MISSION shRNA Lentiviral Transduction Particles
orthodenticle homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021728.2-1932s1c1
Sequence:CCGGGCACTGAAACTTTACGACAAACTCGAGTTTGTCGTAAAGTTTCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021728.2-1143s1c1
Sequence:CCGGCCTCGTGGAAATTCCAGGTTTCTCGAGAAACCTGGAATTTCCACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021728.2-825s1c1
Sequence:CCGGCCATGACCTATACTCAGGCTTCTCGAGAAGCCTGAGTATAGGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021728.2-1393s21c1
Sequence:CCGGGATCATTGGTTATCCTGATTTCTCGAGAAATCAGGATAACCAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021728.2-1542s21c1
Sequence:CCGGTAGCCAATCCTTGGTTGAATCCTCGAGGATTCAACCAAGGATTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks