EMAIL THIS PAGE TO A FRIEND

OVOL1

ovo-like 1(Drosophila)

Synonyms: HOVO1
UniProtKB ID: O14753, Q6PCB1
Gene ID:
Human(5017) Summary: This gene encodes a putative zinc finger containing transcription factor that is highly similar to homologous protein in Drosophila and mouse. Based on known functions in these species, this protein is likely involved in hair formation and spermatogenesis in human as well. [provided by RefSeq, Aug 2011]
Mouse(18426) OVO homolog-like 1 (Drosophila)
Rat(309164) ovo-like 1(Drosophila)
Zebrafish(792456) ovo-like 1 (Drosophila)
dog(483727) ovo-like 1(Drosophila)
cow(513727) ovo-like 1(Drosophila)
domestic cat(101097096) ovo-like 1(Drosophila)
Goat(100861123) ovo-like 1(Drosophila)
sheep(101102686) ovo-like 1(Drosophila)
domestic guinea pig(100724920) ovo-like 1(Drosophila)
naked mole-rat(101714402) ovo-like 1(Drosophila)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004561 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004561 Rosetta Predictions human pricing
NM_001107572 Rosetta Predictions rat pricing
NM_019935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179350 predicted 752
2 SASI_Hs01_00179351 predicted 1270
3 SASI_Hs01_00179352 predicted 680
4 SASI_Hs01_00179353 predicted 1287
5 SASI_Hs01_00179354 predicted 677
6 SASI_Hs01_00179355 predicted 873
7 SASI_Hs01_00179356 predicted 1048
8 SASI_Hs01_00179357 predicted 1208
9 SASI_Hs01_00179358 predicted 1360
10 SASI_Hs02_00337886 predicted 1321
11 SASI_Hs01_00179359 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230155 predicted 820
2 SASI_Rn02_00230156 predicted 1247
3 SASI_Rn02_00230157 predicted 643
4 SASI_Rn02_00230158 predicted 751
5 SASI_Rn02_00230159 predicted 756
6 SASI_Rn02_00230160 predicted 1170
7 SASI_Rn02_00230161 predicted 666
8 SASI_Rn02_00230162 predicted 676
9 SASI_Rn02_00230163 predicted 901
10 SASI_Rn02_00230164 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120877 predicted 1134
2 SASI_Mm01_00120878 predicted 1311
3 SASI_Mm01_00120879 predicted 350
4 SASI_Mm01_00120880 predicted 785
5 SASI_Mm01_00120881 predicted 1386
6 SASI_Mm01_00120882 predicted 565
7 SASI_Mm01_00120883 predicted 773
8 SASI_Mm01_00120884 predicted 1265
9 SASI_Mm02_00325229 predicted 835
10 SASI_Mm01_00120885 predicted 509
11 SASI_Mm01_00120886 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019935
OVOL1 MISSION shRNA Bacterial Glycerol Stock
ovo-like 1(Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019935.3-1193s21c1
Sequence:CCGGTCCAGGCACACTTGCACAATTCTCGAGAATTGTGCAAGTGTGCCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019935.3-665s21c1
Sequence:CCGGGCGCATGCTGAATCGACACATCTCGAGATGTGTCGATTCAGCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019935.3-1271s21c1
Sequence:CCGGGCTTGGGACCATAGGTGTTTGCTCGAGCAAACACCTATGGTCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019935.2-2501s1c1
Sequence:CCGGCCCACGTTACTGATGTCATAACTCGAGTTATGACATCAGTAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-573s1c1
Sequence:CCGGCTTTCTACGAACCAAGATGAACTCGAGTTCATCTTGGTTCGTAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-467s1c1
Sequence:CCGGGCCTTCGAGACTCCAGCTATACTCGAGTATAGCTGGAGTCTCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-714s1c1
Sequence:CCGGCCTCTGCACTTACTGTGGGAACTCGAGTTCCCACAGTAAGTGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-873s1c1
Sequence:CCGGGCAGCAGAAGTATGCATACAACTCGAGTTGTATGCATACTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019935
OVOL1 MISSION shRNA shRNA Plasmid DNA
ovo-like 1(Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019935.3-1193s21c1
Sequence:CCGGTCCAGGCACACTTGCACAATTCTCGAGAATTGTGCAAGTGTGCCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019935.3-665s21c1
Sequence:CCGGGCGCATGCTGAATCGACACATCTCGAGATGTGTCGATTCAGCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019935.3-1271s21c1
Sequence:CCGGGCTTGGGACCATAGGTGTTTGCTCGAGCAAACACCTATGGTCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019935.2-2501s1c1
Sequence:CCGGCCCACGTTACTGATGTCATAACTCGAGTTATGACATCAGTAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-573s1c1
Sequence:CCGGCTTTCTACGAACCAAGATGAACTCGAGTTCATCTTGGTTCGTAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-467s1c1
Sequence:CCGGGCCTTCGAGACTCCAGCTATACTCGAGTATAGCTGGAGTCTCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-714s1c1
Sequence:CCGGCCTCTGCACTTACTGTGGGAACTCGAGTTCCCACAGTAAGTGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-873s1c1
Sequence:CCGGGCAGCAGAAGTATGCATACAACTCGAGTTGTATGCATACTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019935
OVOL1 MISSION shRNA Lentiviral Transduction Particles
ovo-like 1(Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019935.3-1193s21c1
Sequence:CCGGTCCAGGCACACTTGCACAATTCTCGAGAATTGTGCAAGTGTGCCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019935.3-665s21c1
Sequence:CCGGGCGCATGCTGAATCGACACATCTCGAGATGTGTCGATTCAGCATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019935.3-1271s21c1
Sequence:CCGGGCTTGGGACCATAGGTGTTTGCTCGAGCAAACACCTATGGTCCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019935.2-2501s1c1
Sequence:CCGGCCCACGTTACTGATGTCATAACTCGAGTTATGACATCAGTAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-573s1c1
Sequence:CCGGCTTTCTACGAACCAAGATGAACTCGAGTTCATCTTGGTTCGTAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-467s1c1
Sequence:CCGGGCCTTCGAGACTCCAGCTATACTCGAGTATAGCTGGAGTCTCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-714s1c1
Sequence:CCGGCCTCTGCACTTACTGTGGGAACTCGAGTTCCCACAGTAAGTGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019935.2-873s1c1
Sequence:CCGGGCAGCAGAAGTATGCATACAACTCGAGTTGTATGCATACTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004561
OVOL1 MISSION shRNA Bacterial Glycerol Stock
ovo-like 1(Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004561.2-2356s21c1
Sequence:GTACCGGAGGATTTGATGGCTACCAAATCTCGAGATTTGGTAGCCATCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-888s21c1
Sequence:CCGGCTCACCTCAAGAAGATCCATGCTCGAGCATGGATCTTCTTGAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-797s21c1
Sequence:CCGGCTCAAGAGACACGTCCGAACTCTCGAGAGTTCGGACGTGTCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-729s21c1
Sequence:CCGGAGTGTCACAACGACGTCAAGACTCGAGTCTTGACGTCGTTGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-913s21c1
Sequence:CCGGGCAGCAGAAGTACGCGTACAACTCGAGTTGTACGCGTACTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004561.2-1912s1c1
Sequence:CCGGGCTTCTATTTATCCTGGACATCTCGAGATGTCCAGGATAAATAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-494s1c1
Sequence:CCGGGCTTTGAACATGAGCCTTCGACTCGAGTCGAAGGCTCATGTTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-1070s1c1
Sequence:CCGGGCACTACAGAACACTGTCACTCTCGAGAGTGACAGTGTTCTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-718s1c1
Sequence:CCGGCCGCCACATGAAGTGTCACAACTCGAGTTGTGACACTTCATGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-623s1c1
Sequence:CCGGACCAAGATGAAGGTGACCCTTCTCGAGAAGGGTCACCTTCATCTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004561
OVOL1 MISSION shRNA shRNA Plasmid DNA
ovo-like 1(Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004561.2-2356s21c1
Sequence:GTACCGGAGGATTTGATGGCTACCAAATCTCGAGATTTGGTAGCCATCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-888s21c1
Sequence:CCGGCTCACCTCAAGAAGATCCATGCTCGAGCATGGATCTTCTTGAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-797s21c1
Sequence:CCGGCTCAAGAGACACGTCCGAACTCTCGAGAGTTCGGACGTGTCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-729s21c1
Sequence:CCGGAGTGTCACAACGACGTCAAGACTCGAGTCTTGACGTCGTTGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-913s21c1
Sequence:CCGGGCAGCAGAAGTACGCGTACAACTCGAGTTGTACGCGTACTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004561.2-1912s1c1
Sequence:CCGGGCTTCTATTTATCCTGGACATCTCGAGATGTCCAGGATAAATAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-494s1c1
Sequence:CCGGGCTTTGAACATGAGCCTTCGACTCGAGTCGAAGGCTCATGTTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-1070s1c1
Sequence:CCGGGCACTACAGAACACTGTCACTCTCGAGAGTGACAGTGTTCTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-718s1c1
Sequence:CCGGCCGCCACATGAAGTGTCACAACTCGAGTTGTGACACTTCATGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-623s1c1
Sequence:CCGGACCAAGATGAAGGTGACCCTTCTCGAGAAGGGTCACCTTCATCTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004561
OVOL1 MISSION shRNA Lentiviral Transduction Particles
ovo-like 1(Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004561.2-2356s21c1
Sequence:GTACCGGAGGATTTGATGGCTACCAAATCTCGAGATTTGGTAGCCATCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-888s21c1
Sequence:CCGGCTCACCTCAAGAAGATCCATGCTCGAGCATGGATCTTCTTGAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-797s21c1
Sequence:CCGGCTCAAGAGACACGTCCGAACTCTCGAGAGTTCGGACGTGTCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-729s21c1
Sequence:CCGGAGTGTCACAACGACGTCAAGACTCGAGTCTTGACGTCGTTGTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004561.2-913s21c1
Sequence:CCGGGCAGCAGAAGTACGCGTACAACTCGAGTTGTACGCGTACTTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004561.2-1912s1c1
Sequence:CCGGGCTTCTATTTATCCTGGACATCTCGAGATGTCCAGGATAAATAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-494s1c1
Sequence:CCGGGCTTTGAACATGAGCCTTCGACTCGAGTCGAAGGCTCATGTTCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-1070s1c1
Sequence:CCGGGCACTACAGAACACTGTCACTCTCGAGAGTGACAGTGTTCTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-718s1c1
Sequence:CCGGCCGCCACATGAAGTGTCACAACTCGAGTTGTGACACTTCATGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004561.2-623s1c1
Sequence:CCGGACCAAGATGAAGGTGACCCTTCTCGAGAAGGGTCACCTTCATCTTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks