EMAIL THIS PAGE TO A FRIEND

OVOL2

ovo-like 2 (Drosophila)

Synonyms: EUROIMAGE566589 ZNF339
UniProtKB ID: Q9BRP0, Q5T8B4, Q9BX22, Q9HA54, Q9Y4M0
Gene ID:
Mouse(107586) ovo-like 2 (Drosophila)
Rat(296201) ovo-like 2 (Drosophila)
naked mole-rat(101714586) ovo-like 2 (Drosophila)
domestic guinea pig(100726501) ovo-like 2 (Drosophila)
sheep(101122297) ovo-like 2 (Drosophila)
chicken(416720) ovo-like 2 (Drosophila)
domestic cat(101099541) ovo-like 2 (Drosophila)
cow(532761) ovo-like 2 (Drosophila)
dog(485753) ovo-like 2 (Drosophila)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021220 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060571 MISSION® esiRNA esiRNA targeting mouse Ovol2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021220 Rosetta Predictions human pricing
NM_001106519 Rosetta Predictions rat pricing
NM_026924 Rosetta Predictions mouse pricing
NM_152947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105962 predicted 750
2 SASI_Hs01_00105963 predicted 750
3 SASI_Hs01_00105964 predicted 621
4 SASI_Hs01_00105965 predicted 744
5 SASI_Hs01_00105966 predicted 690
6 SASI_Hs01_00105967 predicted 621
7 SASI_Hs01_00105968 predicted 677
8 SASI_Hs01_00105969 predicted 755
9 SASI_Hs01_00105970 predicted 621
10 SASI_Hs01_00105971 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219758 predicted 600
2 SASI_Rn02_00219759 predicted 668
3 SASI_Rn02_00219760 predicted 575
4 SASI_Rn02_00219761 predicted 305
5 SASI_Rn02_00219762 predicted 403
6 SASI_Rn02_00219763 predicted 441
7 SASI_Rn02_00219764 predicted 649
8 SASI_Rn02_00219765 predicted 339
9 SASI_Rn02_00219766 predicted 297
10 SASI_Rn02_00219767 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331210 predicted 549
2 SASI_Mm01_00156856 predicted 689
3 SASI_Mm02_00331211 predicted 922
4 SASI_Mm02_00331212 predicted 657
5 SASI_Mm01_00156858 predicted 826
6 SASI_Mm01_00156859 predicted 781
7 SASI_Mm02_00331213 predicted 963
8 SASI_Mm02_00331214 predicted 607
9 SASI_Mm02_00331215 predicted 856
10 SASI_Mm02_00331216 predicted 897
11 SASI_Mm01_00156854 predicted 667
12 SASI_Mm01_00156855 predicted 624
13 SASI_Mm01_00156857 predicted 815
14 SASI_Mm01_00156860 predicted 773
15 SASI_Mm01_00156861 predicted 768
16 SASI_Mm01_00156862 predicted 772
17 SASI_Mm01_00156863 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342844 predicted 292
2 SASI_Mm01_00192407 predicted 424
3 SASI_Mm02_00342845 predicted 663
4 SASI_Mm02_00342846 predicted 393
5 SASI_Mm01_00192409 predicted 573
6 SASI_Mm01_00192410 predicted 515
7 SASI_Mm02_00342847 predicted 707
8 SASI_Mm02_00342848 predicted 352
9 SASI_Mm02_00342849 predicted 592
10 SASI_Mm02_00342850 predicted 638
11 SASI_Mm01_00192405 predicted 416
12 SASI_Mm01_00192406 predicted 368
13 SASI_Mm01_00192408 predicted 560
14 SASI_Mm01_00192411 predicted 519
15 SASI_Mm01_00192412 predicted 501
16 SASI_Mm01_00192413 predicted 512
17 SASI_Mm01_00192414 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026924
OVOL2 MISSION shRNA Bacterial Glycerol Stock
ovo-like 2 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026924.2-1082s1c1
Sequence:CCGGGCCACGTTTACTCCGACTTATCTCGAGATAAGTCGGAGTAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-555s1c1
Sequence:CCGGGCGACAACTCTGTGATTCACACTCGAGTGTGAATCACAGAGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-556s1c1
Sequence:CCGGCGACAACTCTGTGATTCACAACTCGAGTTGTGAATCACAGAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-613s1c1
Sequence:CCGGCATGCTCAACCGTCACCTTAACTCGAGTTAAGGTGACGGTTGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-908s1c1
Sequence:CCGGCTGCATGTGAACAGTGACCATCTCGAGATGGTCACTGTTCACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026924.3-1166s21c1
Sequence:CCGGTTGGGACAGCAACAGTAAGAACTCGAGTTCTTACTGTTGCTGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026924.3-581s21c1
Sequence:CCGGGACCTTTGTGGCAAGAGCTTCCTCGAGGAAGCTCTTGCCACAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026924.3-1216s21c1
Sequence:CCGGCAACAGGCCCTGTGAATTGTTCTCGAGAACAATTCACAGGGCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026924
OVOL2 MISSION shRNA shRNA Plasmid DNA
ovo-like 2 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026924.2-1082s1c1
Sequence:CCGGGCCACGTTTACTCCGACTTATCTCGAGATAAGTCGGAGTAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-555s1c1
Sequence:CCGGGCGACAACTCTGTGATTCACACTCGAGTGTGAATCACAGAGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-556s1c1
Sequence:CCGGCGACAACTCTGTGATTCACAACTCGAGTTGTGAATCACAGAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-613s1c1
Sequence:CCGGCATGCTCAACCGTCACCTTAACTCGAGTTAAGGTGACGGTTGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-908s1c1
Sequence:CCGGCTGCATGTGAACAGTGACCATCTCGAGATGGTCACTGTTCACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026924.3-1166s21c1
Sequence:CCGGTTGGGACAGCAACAGTAAGAACTCGAGTTCTTACTGTTGCTGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026924.3-581s21c1
Sequence:CCGGGACCTTTGTGGCAAGAGCTTCCTCGAGGAAGCTCTTGCCACAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026924.3-1216s21c1
Sequence:CCGGCAACAGGCCCTGTGAATTGTTCTCGAGAACAATTCACAGGGCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026924
OVOL2 MISSION shRNA Lentiviral Transduction Particles
ovo-like 2 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026924.2-1082s1c1
Sequence:CCGGGCCACGTTTACTCCGACTTATCTCGAGATAAGTCGGAGTAAACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-555s1c1
Sequence:CCGGGCGACAACTCTGTGATTCACACTCGAGTGTGAATCACAGAGTTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-556s1c1
Sequence:CCGGCGACAACTCTGTGATTCACAACTCGAGTTGTGAATCACAGAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-613s1c1
Sequence:CCGGCATGCTCAACCGTCACCTTAACTCGAGTTAAGGTGACGGTTGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026924.2-908s1c1
Sequence:CCGGCTGCATGTGAACAGTGACCATCTCGAGATGGTCACTGTTCACATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026924.3-1166s21c1
Sequence:CCGGTTGGGACAGCAACAGTAAGAACTCGAGTTCTTACTGTTGCTGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026924.3-581s21c1
Sequence:CCGGGACCTTTGTGGCAAGAGCTTCCTCGAGGAAGCTCTTGCCACAAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026924.3-1216s21c1
Sequence:CCGGCAACAGGCCCTGTGAATTGTTCTCGAGAACAATTCACAGGGCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021220
OVOL2 MISSION shRNA Bacterial Glycerol Stock
ovo-like 2 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-752s1c1
Sequence:CCGGCAGGCATTCGTCCCTACAAATCTCGAGATTTGTAGGGACGAATGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-846s1c1
Sequence:CCGGGCAGCAGTATGCCTATAAGCACTCGAGTGCTTATAGGCATACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-648s1c1
Sequence:CCGGCCGTCACCTCAAGTGCCACAACTCGAGTTGTGGCACTTGAGGTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021220.2-301s21c1
Sequence:CCGGGATGAGCTCCCGGATGAGAAACTCGAGTTTCTCATCCGGGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1283s21c1
Sequence:CCGGAGTTGCTCACATTCACCAAAGCTCGAGCTTTGGTGAATGTGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1203s21c1
Sequence:CCGGCATCAGCAGTAGGGTCCATTCCTCGAGGAATGGACCCTACTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1093s21c1
Sequence:CCGGACGTTCACACTGCCACGTATGCTCGAGCATACGTGGCAGTGTGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021220.2-1018s21c1
Sequence:CCGGACATCCGCACACCAGGAGAATCTCGAGATTCTCCTGGTGTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021220
OVOL2 MISSION shRNA shRNA Plasmid DNA
ovo-like 2 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-752s1c1
Sequence:CCGGCAGGCATTCGTCCCTACAAATCTCGAGATTTGTAGGGACGAATGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-846s1c1
Sequence:CCGGGCAGCAGTATGCCTATAAGCACTCGAGTGCTTATAGGCATACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-648s1c1
Sequence:CCGGCCGTCACCTCAAGTGCCACAACTCGAGTTGTGGCACTTGAGGTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021220.2-301s21c1
Sequence:CCGGGATGAGCTCCCGGATGAGAAACTCGAGTTTCTCATCCGGGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1283s21c1
Sequence:CCGGAGTTGCTCACATTCACCAAAGCTCGAGCTTTGGTGAATGTGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1203s21c1
Sequence:CCGGCATCAGCAGTAGGGTCCATTCCTCGAGGAATGGACCCTACTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1093s21c1
Sequence:CCGGACGTTCACACTGCCACGTATGCTCGAGCATACGTGGCAGTGTGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021220.2-1018s21c1
Sequence:CCGGACATCCGCACACCAGGAGAATCTCGAGATTCTCCTGGTGTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021220
OVOL2 MISSION shRNA Lentiviral Transduction Particles
ovo-like 2 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-752s1c1
Sequence:CCGGCAGGCATTCGTCCCTACAAATCTCGAGATTTGTAGGGACGAATGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-846s1c1
Sequence:CCGGGCAGCAGTATGCCTATAAGCACTCGAGTGCTTATAGGCATACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021220.2-648s1c1
Sequence:CCGGCCGTCACCTCAAGTGCCACAACTCGAGTTGTGGCACTTGAGGTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021220.2-301s21c1
Sequence:CCGGGATGAGCTCCCGGATGAGAAACTCGAGTTTCTCATCCGGGAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1283s21c1
Sequence:CCGGAGTTGCTCACATTCACCAAAGCTCGAGCTTTGGTGAATGTGAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1203s21c1
Sequence:CCGGCATCAGCAGTAGGGTCCATTCCTCGAGGAATGGACCCTACTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021220.2-1093s21c1
Sequence:CCGGACGTTCACACTGCCACGTATGCTCGAGCATACGTGGCAGTGTGAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021220.2-1018s21c1
Sequence:CCGGACATCCGCACACCAGGAGAATCTCGAGATTCTCCTGGTGTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks