EMAIL THIS PAGE TO A FRIEND

OXER1

oxoeicosanoid (OXE) receptor 1

Synonyms: GPCR GPR170 TG1019
UniProtKB ID: Q8TDS5, Q86WP7, Q8NGW4
Gene ID:
dog(481349) oxoeicosanoid (OXE) receptor 1
cow(786807) oxoeicosanoid (OXE) receptor 1
cow(540198) oxoeicosanoid (OXE) receptor 1
domestic cat(101098047) oxoeicosanoid (OXE) receptor 1
sheep(101116561) oxoeicosanoid (OXE) receptor 1
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148962 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142961 MISSION® esiRNA esiRNA human OXER1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148962 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163176 predicted 563
2 SASI_Hs01_00163177 predicted 1138
3 SASI_Hs02_00365677 predicted 638
4 SASI_Hs01_00163179 predicted 1528
5 SASI_Hs02_00365678 predicted 792
6 SASI_Hs02_00365679 predicted 636
7 SASI_Hs01_00163181 predicted 840
8 SASI_Hs01_00163182 predicted 872
9 SASI_Hs01_00163183 predicted 1469
10 SASI_Hs01_00163184 predicted 1526
11 SASI_Hs01_00163178 predicted 1528
12 SASI_Hs01_00163180 predicted 971
13 SASI_Hs01_00163185 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148962
OXER1 MISSION shRNA Bacterial Glycerol Stock
oxoeicosanoid (OXE) receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148962.3-1508s1c1
Sequence:CCGGGCAGGGAGAGAAACCCACCTACTCGAGTAGGTGGGTTTCTCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-640s1c1
Sequence:CCGGCGCACTCAACCGCTACCTGAACTCGAGTTCAGGTAGCGGTTGAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-193s1c1
Sequence:CCGGGCAGCCCATGGAACTTCATAACTCGAGTTATGAAGTTCCATGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-409s1c1
Sequence:CCGGGAACAGTTTGGCCCTCTTCATCTCGAGATGAAGAGGGCCAAACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-1102s1c1
Sequence:CCGGCCTGGCCTTCACCTACCTCAACTCGAGTTGAGGTAGGTGAAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-194s21c1
Sequence:CCGGCAGCCCATGGAACTTCATAACCTCGAGGTTATGAAGTTCCATGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-879s21c1
Sequence:CCGGCGCTCATCCTCTTTGCTATTGCTCGAGCAATAGCAAAGAGGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-1005s21c1
Sequence:CCGGTCTTGCCCAGCATCATCTTTGCTCGAGCAAAGATGATGCTGGGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-112s21c1
Sequence:CCGGAGTGCCAATCATCCCACTTTGCTCGAGCAAAGTGGGATGATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148962
OXER1 MISSION shRNA shRNA Plasmid DNA
oxoeicosanoid (OXE) receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148962.3-1508s1c1
Sequence:CCGGGCAGGGAGAGAAACCCACCTACTCGAGTAGGTGGGTTTCTCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-640s1c1
Sequence:CCGGCGCACTCAACCGCTACCTGAACTCGAGTTCAGGTAGCGGTTGAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-193s1c1
Sequence:CCGGGCAGCCCATGGAACTTCATAACTCGAGTTATGAAGTTCCATGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-409s1c1
Sequence:CCGGGAACAGTTTGGCCCTCTTCATCTCGAGATGAAGAGGGCCAAACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-1102s1c1
Sequence:CCGGCCTGGCCTTCACCTACCTCAACTCGAGTTGAGGTAGGTGAAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-194s21c1
Sequence:CCGGCAGCCCATGGAACTTCATAACCTCGAGGTTATGAAGTTCCATGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-879s21c1
Sequence:CCGGCGCTCATCCTCTTTGCTATTGCTCGAGCAATAGCAAAGAGGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-1005s21c1
Sequence:CCGGTCTTGCCCAGCATCATCTTTGCTCGAGCAAAGATGATGCTGGGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-112s21c1
Sequence:CCGGAGTGCCAATCATCCCACTTTGCTCGAGCAAAGTGGGATGATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148962
OXER1 MISSION shRNA Lentiviral Transduction Particles
oxoeicosanoid (OXE) receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148962.3-1508s1c1
Sequence:CCGGGCAGGGAGAGAAACCCACCTACTCGAGTAGGTGGGTTTCTCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-640s1c1
Sequence:CCGGCGCACTCAACCGCTACCTGAACTCGAGTTCAGGTAGCGGTTGAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-193s1c1
Sequence:CCGGGCAGCCCATGGAACTTCATAACTCGAGTTATGAAGTTCCATGGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-409s1c1
Sequence:CCGGGAACAGTTTGGCCCTCTTCATCTCGAGATGAAGAGGGCCAAACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148962.3-1102s1c1
Sequence:CCGGCCTGGCCTTCACCTACCTCAACTCGAGTTGAGGTAGGTGAAGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-194s21c1
Sequence:CCGGCAGCCCATGGAACTTCATAACCTCGAGGTTATGAAGTTCCATGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-879s21c1
Sequence:CCGGCGCTCATCCTCTTTGCTATTGCTCGAGCAATAGCAAAGAGGATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-1005s21c1
Sequence:CCGGTCTTGCCCAGCATCATCTTTGCTCGAGCAAAGATGATGCTGGGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148962.4-112s21c1
Sequence:CCGGAGTGCCAATCATCCCACTTTGCTCGAGCAAAGTGGGATGATTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks