EMAIL THIS PAGE TO A FRIEND

P2RY4

pyrimidinergic receptor P2Y, G-protein coupled, 4

Synonyms: NRU P2P P2Y4 UNR
UniProtKB ID: P51582, Q4VBB7, Q4VBB8, Q502W2, Q5JT22
Gene ID:
Human(5030) Summary: The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is responsive to uridine nucleotides, partially responsive to ATP, and not responsive to ADP. [provided by RefSeq, Jul 2008]
Mouse(57385) pyrimidinergic receptor P2Y, G-protein coupled, 4
Rat(63843) pyrimidinergic receptor P2Y, G-protein coupled, 4
dog(100688008) pyrimidinergic receptor P2Y, G-protein coupled, 4
cow(514653) pyrimidinergic receptor P2Y, G-protein coupled, 4
domestic cat(101087905) pyrimidinergic receptor P2Y, G-protein coupled, 4
sheep(101123185) pyrimidinergic receptor P2Y, G-protein coupled, 4
domestic guinea pig(100716457) pyrimidinergic receptor P2Y, G-protein coupled, 4
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P178 Pyridoxal phosphate-6-azo(benzene-2,4-disulfonic acid) tetrasodium salt hydrate solid, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002565 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104481 MISSION® esiRNA esiRNA human P2RY4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002565 Rosetta Predictions human pricing
NM_031680 Rosetta Predictions rat pricing
NM_020621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083650 predicted 530
2 SASI_Hs02_00334057 predicted 997
3 SASI_Hs01_00083652 predicted 1417
4 SASI_Hs01_00083653 predicted 258
5 SASI_Hs01_00083654 predicted 1328
6 SASI_Hs01_00083655 predicted 293
7 SASI_Hs01_00083656 predicted 1020
8 SASI_Hs01_00083657 predicted 1115
9 SASI_Hs01_00083658 predicted 1348
10 SASI_Hs01_00083659 predicted 962
11 SASI_Hs01_00083651 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110434 predicted 424
2 SASI_Rn01_00110435 predicted 855
3 SASI_Rn01_00110436 predicted 868
4 SASI_Rn01_00110437 predicted 582
5 SASI_Rn01_00110438 predicted 830
6 SASI_Rn01_00110439 predicted 621
7 SASI_Rn01_00110440 predicted 648
8 SASI_Rn01_00110441 predicted 703
9 SASI_Rn01_00110442 predicted 325
10 SASI_Rn01_00110443 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325745 predicted 857
2 SASI_Mm02_00325746 predicted 875
3 SASI_Mm02_00325747 predicted 356
4 SASI_Mm02_00325748 predicted 1237
5 SASI_Mm02_00325749 predicted 854
6 SASI_Mm02_00325750 predicted 492
7 SASI_Mm02_00325751 predicted 946
8 SASI_Mm02_00325752 predicted 1373
9 SASI_Mm02_00325753 predicted 1351
10 SASI_Mm02_00325754 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020621
P2RY4 MISSION shRNA Bacterial Glycerol Stock
pyrimidinergic receptor P2Y, G-protein coupled, 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-785s21c1
Sequence:CCGGTCGTGCCCAACCTCTTCTTTGCTCGAGCAAAGAAGAGGTTGGGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-355s21c1
Sequence:CCGGGATGGTGATTGTAAGTTTAATCTCGAGATTAAACTTACAATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020621.4-1727s21c1
Sequence:CCGGCATAGCACAGATACCATATAACTCGAGTTATATGGTATCTGTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-1362s21c1
Sequence:CCGGTTATGAGGGTGACCGATTATACTCGAGTATAATCGGTCACCCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1080s1c1
Sequence:CCGGGCACAATTTATTACCTGGCAACTCGAGTTGCCAGGTAATAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1169s1c1
Sequence:CCGGGCCAGTGCTAATAGCTGTCTTCTCGAGAAGACAGCTATTAGCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1292s1c1
Sequence:CCGGGCATTGGTGACCCTACATGAACTCGAGTTCATGTAGGGTCACCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-877s1c1
Sequence:CCGGCGTATACTTCAGTTCCACAATCTCGAGATTGTGGAACTGAAGTATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020621.2-3990s1c1
Sequence:CCGGCGCCAATAGTTACATAAACTTCTCGAGAAGTTTATGTAACTATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020621
P2RY4 MISSION shRNA shRNA Plasmid DNA
pyrimidinergic receptor P2Y, G-protein coupled, 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-785s21c1
Sequence:CCGGTCGTGCCCAACCTCTTCTTTGCTCGAGCAAAGAAGAGGTTGGGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-355s21c1
Sequence:CCGGGATGGTGATTGTAAGTTTAATCTCGAGATTAAACTTACAATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020621.4-1727s21c1
Sequence:CCGGCATAGCACAGATACCATATAACTCGAGTTATATGGTATCTGTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-1362s21c1
Sequence:CCGGTTATGAGGGTGACCGATTATACTCGAGTATAATCGGTCACCCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1080s1c1
Sequence:CCGGGCACAATTTATTACCTGGCAACTCGAGTTGCCAGGTAATAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1169s1c1
Sequence:CCGGGCCAGTGCTAATAGCTGTCTTCTCGAGAAGACAGCTATTAGCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1292s1c1
Sequence:CCGGGCATTGGTGACCCTACATGAACTCGAGTTCATGTAGGGTCACCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-877s1c1
Sequence:CCGGCGTATACTTCAGTTCCACAATCTCGAGATTGTGGAACTGAAGTATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020621.2-3990s1c1
Sequence:CCGGCGCCAATAGTTACATAAACTTCTCGAGAAGTTTATGTAACTATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020621
P2RY4 MISSION shRNA Lentiviral Transduction Particles
pyrimidinergic receptor P2Y, G-protein coupled, 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-785s21c1
Sequence:CCGGTCGTGCCCAACCTCTTCTTTGCTCGAGCAAAGAAGAGGTTGGGCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-355s21c1
Sequence:CCGGGATGGTGATTGTAAGTTTAATCTCGAGATTAAACTTACAATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421778    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020621.4-1727s21c1
Sequence:CCGGCATAGCACAGATACCATATAACTCGAGTTATATGGTATCTGTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020621.4-1362s21c1
Sequence:CCGGTTATGAGGGTGACCGATTATACTCGAGTATAATCGGTCACCCTCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1080s1c1
Sequence:CCGGGCACAATTTATTACCTGGCAACTCGAGTTGCCAGGTAATAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1169s1c1
Sequence:CCGGGCCAGTGCTAATAGCTGTCTTCTCGAGAAGACAGCTATTAGCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-1292s1c1
Sequence:CCGGGCATTGGTGACCCTACATGAACTCGAGTTCATGTAGGGTCACCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020621.2-877s1c1
Sequence:CCGGCGTATACTTCAGTTCCACAATCTCGAGATTGTGGAACTGAAGTATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020621.2-3990s1c1
Sequence:CCGGCGCCAATAGTTACATAAACTTCTCGAGAAGTTTATGTAACTATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002565
P2RY4 MISSION shRNA Bacterial Glycerol Stock
pyrimidinergic receptor P2Y, G-protein coupled, 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-1025s21c1
Sequence:CCGGACATTGTCAACGTGGTCTATACTCGAGTATAGACCACGTTGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-963s21c1
Sequence:CCGGCCACATCACCCGCACCATTTACTCGAGTAAATGGTGCGGGTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-446s21c1
Sequence:CCGGCCACCCTCATCTACTATTATGCTCGAGCATAATAGTAGATGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-1259s21c1
Sequence:CCGGCTAGGGCAGATAGATTGTAACCTCGAGGTTACAATCTATCTGCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-1235s1c1
Sequence:CCGGCCCAGGACAGTAGCTGCTCTACTCGAGTAGAGCAGCTACTGTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-412s1c1
Sequence:CCGGGCATTGTCAGACACCTTGTATCTCGAGATACAAGGTGTCTGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-444s1c1
Sequence:CCGGGCCCACCCTCATCTACTATTACTCGAGTAATAGTAGATGAGGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-751s1c1
Sequence:CCGGCCTGAAGAGTTTGACCACTATCTCGAGATAGTGGTCAAACTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-686s1c1
Sequence:CCGGCCAACCTGTTCTTTGTCACAACTCGAGTTGTGACAAAGAACAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002565
P2RY4 MISSION shRNA shRNA Plasmid DNA
pyrimidinergic receptor P2Y, G-protein coupled, 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-1025s21c1
Sequence:CCGGACATTGTCAACGTGGTCTATACTCGAGTATAGACCACGTTGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-963s21c1
Sequence:CCGGCCACATCACCCGCACCATTTACTCGAGTAAATGGTGCGGGTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-446s21c1
Sequence:CCGGCCACCCTCATCTACTATTATGCTCGAGCATAATAGTAGATGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-1259s21c1
Sequence:CCGGCTAGGGCAGATAGATTGTAACCTCGAGGTTACAATCTATCTGCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-1235s1c1
Sequence:CCGGCCCAGGACAGTAGCTGCTCTACTCGAGTAGAGCAGCTACTGTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-412s1c1
Sequence:CCGGGCATTGTCAGACACCTTGTATCTCGAGATACAAGGTGTCTGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-444s1c1
Sequence:CCGGGCCCACCCTCATCTACTATTACTCGAGTAATAGTAGATGAGGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-751s1c1
Sequence:CCGGCCTGAAGAGTTTGACCACTATCTCGAGATAGTGGTCAAACTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-686s1c1
Sequence:CCGGCCAACCTGTTCTTTGTCACAACTCGAGTTGTGACAAAGAACAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002565
P2RY4 MISSION shRNA Lentiviral Transduction Particles
pyrimidinergic receptor P2Y, G-protein coupled, 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-1025s21c1
Sequence:CCGGACATTGTCAACGTGGTCTATACTCGAGTATAGACCACGTTGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-963s21c1
Sequence:CCGGCCACATCACCCGCACCATTTACTCGAGTAAATGGTGCGGGTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-446s21c1
Sequence:CCGGCCACCCTCATCTACTATTATGCTCGAGCATAATAGTAGATGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002565.3-1259s21c1
Sequence:CCGGCTAGGGCAGATAGATTGTAACCTCGAGGTTACAATCTATCTGCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-1235s1c1
Sequence:CCGGCCCAGGACAGTAGCTGCTCTACTCGAGTAGAGCAGCTACTGTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-412s1c1
Sequence:CCGGGCATTGTCAGACACCTTGTATCTCGAGATACAAGGTGTCTGACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-444s1c1
Sequence:CCGGGCCCACCCTCATCTACTATTACTCGAGTAATAGTAGATGAGGGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-751s1c1
Sequence:CCGGCCTGAAGAGTTTGACCACTATCTCGAGATAGTGGTCAAACTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002565.2-686s1c1
Sequence:CCGGCCAACCTGTTCTTTGTCACAACTCGAGTTGTGACAAAGAACAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks