EMAIL THIS PAGE TO A FRIEND

P4HTM

prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)

Synonyms: EGLN4 HIFPH4 P4H-TM PH-4 PH4 PHD4
UniProtKB ID: Q9NXG6, Q6PAG6, Q8TCJ9, Q8WV55, Q96F22, Q9BW77
Gene ID:
Human(54681) Summary: The product of this gene belongs to the family of prolyl 4-hydroxylases. This protein is a prolyl hydroxylase that may be involved in the degradation of hypoxia-inducible transcription factors under normoxia. It plays a role in adaptation to hypoxia and may be related to cellular oxygen sensing. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(74443) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Rat(301008) prolyl 4-hydroxylase, transmembrane
chicken(100859583) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
dog(100683495) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
cow(538626) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Horse(100063429) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
domestic cat(101087386) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Domestic Rabbit(100358098) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
naked mole-rat(101709408) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
domestic guinea pig(100726870) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
sheep(101109046) prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017732 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017732 Rosetta Predictions human pricing
NM_177938 Rosetta Predictions human pricing
NM_177939 Rosetta Predictions human pricing
XM_001075237 Rosetta Predictions rat pricing
XM_217285 Rosetta Predictions rat pricing
NM_028944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093078 predicted 993
2 SASI_Hs01_00093079 predicted 1156
3 SASI_Hs01_00093080 predicted 1079
4 SASI_Hs01_00093081 predicted 864
5 SASI_Hs01_00093082 predicted 761
6 SASI_Hs01_00093083 predicted 526
7 SASI_Hs01_00093084 predicted 1038
8 SASI_Hs01_00093085 predicted 1016
9 SASI_Hs01_00093086 predicted 1105
10 SASI_Hs01_00093087 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043320 predicted 988
2 SASI_Hs01_00043321 predicted 1148
3 SASI_Hs01_00043322 predicted 1073
4 SASI_Hs01_00043323 predicted 856
5 SASI_Hs01_00043324 predicted 763
6 SASI_Hs01_00043325 predicted 520
7 SASI_Hs01_00043326 predicted 1026
8 SASI_Hs01_00043327 predicted 1014
9 SASI_Hs01_00043328 predicted 1105
10 SASI_Hs01_00043329 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095208 predicted 989
2 SASI_Hs01_00095209 predicted 1144
3 SASI_Hs01_00095210 predicted 1076
4 SASI_Hs01_00095211 predicted 853
5 SASI_Hs01_00095212 predicted 763
6 SASI_Hs01_00095213 predicted 523
7 SASI_Hs01_00095214 predicted 1031
8 SASI_Hs01_00095215 predicted 1019
9 SASI_Hs01_00095216 predicted 1096
10 SASI_Hs01_00095217 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348918 predicted 1306
2 SASI_Rn02_00348919 predicted 1089
3 SASI_Rn02_00348920 predicted 325
4 SASI_Rn02_00348921 predicted 1492
5 SASI_Rn02_00348922 predicted 1512
6 SASI_Rn02_00348923 predicted 571
7 SASI_Rn02_00348924 predicted 1273
8 SASI_Rn02_00348925 predicted 912
9 SASI_Rn02_00348926 predicted 1289
10 SASI_Rn02_00348927 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377100 predicted 1305
2 SASI_Rn02_00377101 predicted 1086
3 SASI_Rn02_00377102 predicted 325
4 SASI_Rn02_00377103 predicted 1493
5 SASI_Rn02_00377104 predicted 1511
6 SASI_Rn02_00377105 predicted 566
7 SASI_Rn02_00377106 predicted 1269
8 SASI_Rn02_00377107 predicted 911
9 SASI_Rn02_00377108 predicted 1288
10 SASI_Rn02_00377109 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334646 predicted 969
2 SASI_Mm02_00334647 predicted 1185
3 SASI_Mm02_00334648 predicted 722
4 SASI_Mm01_00067079 predicted 818
5 SASI_Mm01_00067080 predicted 983
6 SASI_Mm01_00067083 predicted 1188
7 SASI_Mm02_00334649 predicted 700
8 SASI_Mm02_00334650 predicted 826
9 SASI_Mm02_00334651 predicted 1306
10 SASI_Mm02_00334652 predicted 1110
11 SASI_Mm01_00067074 predicted 761
12 SASI_Mm01_00067075 predicted 964
13 SASI_Mm01_00067076 predicted 1252
14 SASI_Mm01_00067077 predicted 714
15 SASI_Mm01_00067078 predicted 1036
16 SASI_Mm01_00067081 predicted 207
17 SASI_Mm01_00067082 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017732
VALIDATED
P4HTM MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-1569s1c1
Sequence:CCGGCCCACAAGTTGTTTACCCAATCTCGAGATTGGGTAAACAACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017732.2-1123s1c1
Sequence:CCGGCAAGTACATGAGGAGCCACAACTCGAGTTGTGGCTCCTCATGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-869s1c1
Sequence:CCGGCTGCCTACTGAAGAGTATGAACTCGAGTTCATACTCTTCAGTAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-1091s1c1
Sequence:CCGGGAGTTCTCCAACATGGACCTTCTCGAGAAGGTCCATGTTGGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017732.2-791s1c1
Sequence:CCGGCCCGGCTTCCTGACTGATGAACTCGAGTTCATCAGTCAGGAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017732
VALIDATED
P4HTM MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-1569s1c1
Sequence:CCGGCCCACAAGTTGTTTACCCAATCTCGAGATTGGGTAAACAACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017732.2-1123s1c1
Sequence:CCGGCAAGTACATGAGGAGCCACAACTCGAGTTGTGGCTCCTCATGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-869s1c1
Sequence:CCGGCTGCCTACTGAAGAGTATGAACTCGAGTTCATACTCTTCAGTAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-1091s1c1
Sequence:CCGGGAGTTCTCCAACATGGACCTTCTCGAGAAGGTCCATGTTGGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017732.2-791s1c1
Sequence:CCGGCCCGGCTTCCTGACTGATGAACTCGAGTTCATCAGTCAGGAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017732
VALIDATED
P4HTM MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-1569s1c1
Sequence:CCGGCCCACAAGTTGTTTACCCAATCTCGAGATTGGGTAAACAACTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017732.2-1123s1c1
Sequence:CCGGCAAGTACATGAGGAGCCACAACTCGAGTTGTGGCTCCTCATGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-869s1c1
Sequence:CCGGCTGCCTACTGAAGAGTATGAACTCGAGTTCATACTCTTCAGTAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017732.2-1091s1c1
Sequence:CCGGGAGTTCTCCAACATGGACCTTCTCGAGAAGGTCCATGTTGGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_017732.2-791s1c1
Sequence:CCGGCCCGGCTTCCTGACTGATGAACTCGAGTTCATCAGTCAGGAAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028944
P4HTM MISSION shRNA Bacterial Glycerol Stock
prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028944.2-1395s1c1
Sequence:CCGGGATCGCTAACAACTGGATCAACTCGAGTTGATCCAGTTGTTAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028944.2-1063s1c1
Sequence:CCGGCATACCAAGCTGGTAGCCAATCTCGAGATTGGCTACCAGCTTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-1397s21c1
Sequence:CCGGTCGCTAACAACTGGATCAATGCTCGAGCATTGATCCAGTTGTTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-725s21c1
Sequence:CCGGAGATGTACTCTGCAATCAAAGCTCGAGCTTTGATTGCAGAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028944.3-1621s21c1
Sequence:CCGGTGAAGTTCTGGCCGACCTCTTCTCGAGAAGAGGTCGGCCAGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-79s21c1
Sequence:CCGGACAGTCGAGGAGGCCTCAAATCTCGAGATTTGAGGCCTCCTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-1182s21c1
Sequence:CCGGCAACAGGACCTATGATGAAATCTCGAGATTTCATCATAGGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028944
P4HTM MISSION shRNA shRNA Plasmid DNA
prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028944.2-1395s1c1
Sequence:CCGGGATCGCTAACAACTGGATCAACTCGAGTTGATCCAGTTGTTAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028944.2-1063s1c1
Sequence:CCGGCATACCAAGCTGGTAGCCAATCTCGAGATTGGCTACCAGCTTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-1397s21c1
Sequence:CCGGTCGCTAACAACTGGATCAATGCTCGAGCATTGATCCAGTTGTTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-725s21c1
Sequence:CCGGAGATGTACTCTGCAATCAAAGCTCGAGCTTTGATTGCAGAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028944.3-1621s21c1
Sequence:CCGGTGAAGTTCTGGCCGACCTCTTCTCGAGAAGAGGTCGGCCAGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-79s21c1
Sequence:CCGGACAGTCGAGGAGGCCTCAAATCTCGAGATTTGAGGCCTCCTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-1182s21c1
Sequence:CCGGCAACAGGACCTATGATGAAATCTCGAGATTTCATCATAGGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028944
P4HTM MISSION shRNA Lentiviral Transduction Particles
prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180825    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028944.2-1395s1c1
Sequence:CCGGGATCGCTAACAACTGGATCAACTCGAGTTGATCCAGTTGTTAGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184137    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028944.2-1063s1c1
Sequence:CCGGCATACCAAGCTGGTAGCCAATCTCGAGATTGGCTACCAGCTTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-1397s21c1
Sequence:CCGGTCGCTAACAACTGGATCAATGCTCGAGCATTGATCCAGTTGTTAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-725s21c1
Sequence:CCGGAGATGTACTCTGCAATCAAAGCTCGAGCTTTGATTGCAGAGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028944.3-1621s21c1
Sequence:CCGGTGAAGTTCTGGCCGACCTCTTCTCGAGAAGAGGTCGGCCAGAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-79s21c1
Sequence:CCGGACAGTCGAGGAGGCCTCAAATCTCGAGATTTGAGGCCTCCTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028944.3-1182s21c1
Sequence:CCGGCAACAGGACCTATGATGAAATCTCGAGATTTCATCATAGGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks