EMAIL THIS PAGE TO A FRIEND

PABPC3

poly(A) binding protein, cytoplasmic 3

Synonyms: PABP3 PABPL3 tPABP
Species: Human PABPC3(5042)
UniProtKB ID: Q9H361, Q8NHV0, Q9H086
Gene ID:
Human(5042) Summary: Messenger RNA stability and translation initiation are extensively under the control of poly(A)-binding proteins (PABP). See PABPC1 (MIM 604679) for background information.[supplied by OMIM, Jul 2002]
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030979 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030979 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057593 predicted 433
2 SASI_Hs01_00057594 predicted 689
3 SASI_Hs01_00057595 predicted 374
4 SASI_Hs01_00057596 predicted 1184
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030979
VALIDATED
PABPC3 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-1368s1c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030979.2-224s1c1
Sequence:CCGGGCGTATGTGAACTTCCAGCATCTCGAGATGCTGGAAGTTCACATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-1563s1c1
Sequence:CCGGGCACGGTTCCACGGTATAAATCTCGAGATTTATACCGTGGAACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030979.2-2097s1c1
Sequence:CCGGGAACCTTATGTACCGAGCAAACTCGAGTTTGCTCGGTACATAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-632s1c1
Sequence:CCGGCCCAATGTTTACATCAAGAATCTCGAGATTCTTGATGTAAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_030979.2-558s1c1
Sequence:CCGGGCAAAGTATTTGTTGGACAATCTCGAGATTGTCCAACAAATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2129s1c1
Sequence:CCGGGCAAATATAATGCTAGTCCTACTCGAGTAGGACTAGCATTATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2119s1c1
Sequence:CCGGGCAAGGTCTAGCAAATATAATCTCGAGATTATATTTGCTAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2084s1c1
Sequence:CCGGGAAAGGAAACTTTGAACCTTACTCGAGTAAGGTTCAAAGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030979.2-750s1c1
Sequence:CCGGCCAAAGGATTTGGATTTGTAACTCGAGTTACAAATCCAAATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030979.2-1097s1c1
Sequence:CCGGGCCACTAAAGCAGTTACAGAACTCGAGTTCTGTAACTGCTTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030979.2-2084s21c1
Sequence:CCGGGAAAGGAAACTTTGAACCTTACTCGAGTAAGGTTCAAAGTTTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-1097s21c1
Sequence:CCGGGCCACTAAAGCAGTTACAGAACTCGAGTTCTGTAACTGCTTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030979.2-2097s21c1
Sequence:CCGGGAACCTTATGTACCGAGCAAACTCGAGTTTGCTCGGTACATAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-558s21c1
Sequence:CCGGGCAAAGTATTTGTTGGACAATCTCGAGATTGTCCAACAAATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-224s21c1
Sequence:CCGGGCGTATGTGAACTTCCAGCATCTCGAGATGCTGGAAGTTCACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030979
VALIDATED
PABPC3 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-1368s1c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030979.2-224s1c1
Sequence:CCGGGCGTATGTGAACTTCCAGCATCTCGAGATGCTGGAAGTTCACATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-1563s1c1
Sequence:CCGGGCACGGTTCCACGGTATAAATCTCGAGATTTATACCGTGGAACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030979.2-2097s1c1
Sequence:CCGGGAACCTTATGTACCGAGCAAACTCGAGTTTGCTCGGTACATAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-632s1c1
Sequence:CCGGCCCAATGTTTACATCAAGAATCTCGAGATTCTTGATGTAAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_030979.2-558s1c1
Sequence:CCGGGCAAAGTATTTGTTGGACAATCTCGAGATTGTCCAACAAATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2129s1c1
Sequence:CCGGGCAAATATAATGCTAGTCCTACTCGAGTAGGACTAGCATTATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2119s1c1
Sequence:CCGGGCAAGGTCTAGCAAATATAATCTCGAGATTATATTTGCTAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2084s1c1
Sequence:CCGGGAAAGGAAACTTTGAACCTTACTCGAGTAAGGTTCAAAGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030979.2-750s1c1
Sequence:CCGGCCAAAGGATTTGGATTTGTAACTCGAGTTACAAATCCAAATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030979.2-1097s1c1
Sequence:CCGGGCCACTAAAGCAGTTACAGAACTCGAGTTCTGTAACTGCTTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030979.2-2084s21c1
Sequence:CCGGGAAAGGAAACTTTGAACCTTACTCGAGTAAGGTTCAAAGTTTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-1097s21c1
Sequence:CCGGGCCACTAAAGCAGTTACAGAACTCGAGTTCTGTAACTGCTTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030979.2-2097s21c1
Sequence:CCGGGAACCTTATGTACCGAGCAAACTCGAGTTTGCTCGGTACATAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-558s21c1
Sequence:CCGGGCAAAGTATTTGTTGGACAATCTCGAGATTGTCCAACAAATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-224s21c1
Sequence:CCGGGCGTATGTGAACTTCCAGCATCTCGAGATGCTGGAAGTTCACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030979
VALIDATED
PABPC3 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-1368s1c1
Sequence:CCGGCCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030979.2-224s1c1
Sequence:CCGGGCGTATGTGAACTTCCAGCATCTCGAGATGCTGGAAGTTCACATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-1563s1c1
Sequence:CCGGGCACGGTTCCACGGTATAAATCTCGAGATTTATACCGTGGAACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030979.2-2097s1c1
Sequence:CCGGGAACCTTATGTACCGAGCAAACTCGAGTTTGCTCGGTACATAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030979.2-632s1c1
Sequence:CCGGCCCAATGTTTACATCAAGAATCTCGAGATTCTTGATGTAAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_030979.2-558s1c1
Sequence:CCGGGCAAAGTATTTGTTGGACAATCTCGAGATTGTCCAACAAATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2129s1c1
Sequence:CCGGGCAAATATAATGCTAGTCCTACTCGAGTAGGACTAGCATTATATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2119s1c1
Sequence:CCGGGCAAGGTCTAGCAAATATAATCTCGAGATTATATTTGCTAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159954    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030979.2-2084s1c1
Sequence:CCGGGAAAGGAAACTTTGAACCTTACTCGAGTAAGGTTCAAAGTTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030979.2-750s1c1
Sequence:CCGGCCAAAGGATTTGGATTTGTAACTCGAGTTACAAATCCAAATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030979.2-1097s1c1
Sequence:CCGGGCCACTAAAGCAGTTACAGAACTCGAGTTCTGTAACTGCTTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030979.2-2084s21c1
Sequence:CCGGGAAAGGAAACTTTGAACCTTACTCGAGTAAGGTTCAAAGTTTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-1097s21c1
Sequence:CCGGGCCACTAAAGCAGTTACAGAACTCGAGTTCTGTAACTGCTTTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030979.2-2097s21c1
Sequence:CCGGGAACCTTATGTACCGAGCAAACTCGAGTTTGCTCGGTACATAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-558s21c1
Sequence:CCGGGCAAAGTATTTGTTGGACAATCTCGAGATTGTCCAACAAATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030979.2-224s21c1
Sequence:CCGGGCGTATGTGAACTTCCAGCATCTCGAGATGCTGGAAGTTCACATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks