EMAIL THIS PAGE TO A FRIEND

PABPC4L

poly(A) binding protein, cytoplasmic 4-like

UniProtKB ID: P0CB38
Gene ID:
Mouse(241989) poly(A) binding protein, cytoplasmic 4-like
Rat(295010) poly(A) binding protein, cytoplasmic 4-like
sheep(101107635) poly(A) binding protein, cytoplasmic 4-like
domestic guinea pig(100728916) poly(A) binding protein, cytoplasmic 4-like
dog(483825) uncharacterized LOC483825
Horse(100071641) poly(A) binding protein, cytoplasmic 4-like
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302182 ANTI-PABPC4L (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001114734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001114734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001114734 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114734 Rosetta Predictions human pricing
NM_001106429 Rosetta Predictions rat pricing
NM_001101479 Rosetta Predictions mouse pricing
XM_884776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326774 predicted 906
2 SASI_Hs02_00326775 predicted 979
3 SASI_Hs02_00326776 predicted 545
4 SASI_Hs02_00326777 predicted 1015
5 SASI_Hs02_00326778 predicted 535
6 SASI_Hs02_00326779 predicted 797
7 SASI_Hs02_00326780 predicted 671
8 SASI_Hs02_00326781 predicted 1289
9 SASI_Hs02_00326782 predicted 924
10 SASI_Hs02_00326783 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218878 predicted 1017
2 SASI_Rn02_00218879 predicted 417
3 SASI_Rn02_00218880 predicted 858
4 SASI_Rn02_00218881 predicted 574
5 SASI_Rn02_00218882 predicted 563
6 SASI_Rn02_00218883 predicted 1039
7 SASI_Rn02_00218884 predicted 286
8 SASI_Rn02_00218885 predicted 426
9 SASI_Rn02_00218886 predicted 760
10 SASI_Rn02_00218887 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302457 predicted 1018
2 SASI_Mm02_00302458 predicted 331
3 SASI_Mm02_00302459 predicted 768
4 SASI_Mm02_00302460 predicted 948
5 SASI_Mm02_00302461 predicted 491
6 SASI_Mm02_00302462 predicted 1032
7 SASI_Mm02_00302463 predicted 849
8 SASI_Mm02_00302464 predicted 569
9 SASI_Mm02_00302465 predicted 325
10 SASI_Mm02_00302466 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271329 predicted 1011
2 SASI_Mm01_00271330 predicted 947
3 SASI_Mm01_00271331 predicted 1201
4 SASI_Mm01_00271332 predicted 971
5 SASI_Mm01_00271333 predicted 1215
6 SASI_Mm01_00271334 predicted 937
7 SASI_Mm01_00271335 predicted 1157
8 SASI_Mm01_00271336 predicted 999
9 SASI_Mm01_00271337 predicted 1200
10 SASI_Mm01_00271338 predicted 1087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101479
PABPC4L MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 4-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-359s21c1
Sequence:CCGGTAGGCTACGCCTATGTCAATTCTCGAGAATTGACATAGGCGTAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101479.1-4612s21c1
Sequence:CCGGATGGATATGTCTGCGTTATTTCTCGAGAAATAACGCAGACATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-1015s21c1
Sequence:CCGGGAACGACAGGCTGAGTTAAAGCTCGAGCTTTAACTCAGCCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-425s21c1
Sequence:CCGGTTGACGTGATCAAAGGTAAATCTCGAGATTTACCTTTGATCACGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-519s21c1
Sequence:CCGGTCTGGACAAATCCATTGATAACTCGAGTTATCAATGGATTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101479
PABPC4L MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 4-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-359s21c1
Sequence:CCGGTAGGCTACGCCTATGTCAATTCTCGAGAATTGACATAGGCGTAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101479.1-4612s21c1
Sequence:CCGGATGGATATGTCTGCGTTATTTCTCGAGAAATAACGCAGACATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-1015s21c1
Sequence:CCGGGAACGACAGGCTGAGTTAAAGCTCGAGCTTTAACTCAGCCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-425s21c1
Sequence:CCGGTTGACGTGATCAAAGGTAAATCTCGAGATTTACCTTTGATCACGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-519s21c1
Sequence:CCGGTCTGGACAAATCCATTGATAACTCGAGTTATCAATGGATTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101479
PABPC4L MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 4-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-359s21c1
Sequence:CCGGTAGGCTACGCCTATGTCAATTCTCGAGAATTGACATAGGCGTAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101479.1-4612s21c1
Sequence:CCGGATGGATATGTCTGCGTTATTTCTCGAGAAATAACGCAGACATATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-1015s21c1
Sequence:CCGGGAACGACAGGCTGAGTTAAAGCTCGAGCTTTAACTCAGCCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-425s21c1
Sequence:CCGGTTGACGTGATCAAAGGTAAATCTCGAGATTTACCTTTGATCACGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101479.1-519s21c1
Sequence:CCGGTCTGGACAAATCCATTGATAACTCGAGTTATCAATGGATTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114734
VALIDATED
PABPC4L MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein, cytoplasmic 4-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114734.1-1278s21c2
Sequence:CCGGTCTCCTGAGGATGCTACTAAACTCGAGTTTAGTAGCATCCTCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1206s21c2
Sequence:GTACCGGGGATCAATTAGCAGAGTTAAGCTCGAGCTTAACTCTGCTAATTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1006s21c2
Sequence:GTACCGGTGAATGGAAGGGACATAAATGCTCGAGCATTTATGTCCCTTCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114734.1-539s21c2
Sequence:GTACCGGATCTGGAATTGGGAACGTATTCTCGAGAATACGTTCCCAATTCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1662s21c2
Sequence:CCGGCCAAATGAAATGAGGTAATTACTCGAGTAATTACCTCATTTCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114734
VALIDATED
PABPC4L MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein, cytoplasmic 4-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114734.1-1278s21c2
Sequence:CCGGTCTCCTGAGGATGCTACTAAACTCGAGTTTAGTAGCATCCTCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1206s21c2
Sequence:GTACCGGGGATCAATTAGCAGAGTTAAGCTCGAGCTTAACTCTGCTAATTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1006s21c2
Sequence:GTACCGGTGAATGGAAGGGACATAAATGCTCGAGCATTTATGTCCCTTCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114734.1-539s21c2
Sequence:GTACCGGATCTGGAATTGGGAACGTATTCTCGAGAATACGTTCCCAATTCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1662s21c2
Sequence:CCGGCCAAATGAAATGAGGTAATTACTCGAGTAATTACCTCATTTCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114734
VALIDATED
PABPC4L MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein, cytoplasmic 4-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114734.1-1278s21c2
Sequence:CCGGTCTCCTGAGGATGCTACTAAACTCGAGTTTAGTAGCATCCTCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1206s21c2
Sequence:GTACCGGGGATCAATTAGCAGAGTTAAGCTCGAGCTTAACTCTGCTAATTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1006s21c2
Sequence:GTACCGGTGAATGGAAGGGACATAAATGCTCGAGCATTTATGTCCCTTCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114734.1-539s21c2
Sequence:GTACCGGATCTGGAATTGGGAACGTATTCTCGAGAATACGTTCCCAATTCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001114734.1-1662s21c2
Sequence:CCGGCCAAATGAAATGAGGTAATTACTCGAGTAATTACCTCATTTCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks