EMAIL THIS PAGE TO A FRIEND

PACSIN3

protein kinase C and casein kinase substrate in neurons 3

Synonyms: SDPIII
UniProtKB ID: Q9UKS6, A6NH84, Q9H331, Q9NWV9
Gene ID:
Human(29763) Summary: This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(80708) protein kinase C and casein kinase substrate in neurons 3
Rat(311187) protein kinase C and casein kinase substrate in neurons 3
naked mole-rat(101716275) protein kinase C and casein kinase substrate in neurons 3
Domestic Rabbit(100352135) protein kinase C and casein kinase substrate in neurons 3
sheep(101116087) protein kinase C and casein kinase substrate in neurons 3
Zebrafish(393964) protein kinase C and casein kinase substrate in neurons 3
chicken(423186) protein kinase C and casein kinase substrate in neurons 3
dog(475984) protein kinase C and casein kinase substrate in neurons 3
Horse(100057860) protein kinase C and casein kinase substrate in neurons 3
cow(535109) protein kinase C and casein kinase substrate in neurons 3
domestic cat(101091971) protein kinase C and casein kinase substrate in neurons 3
Gene Class: Cytoskeleton
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016223 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016223 Rosetta Predictions human pricing
NM_001009966 Rosetta Predictions rat pricing
XM_579322 Rosetta Predictions rat pricing
NM_028733 Rosetta Predictions mouse pricing
NM_030880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170373 predicted 200
2 SASI_Hs01_00170374 predicted 994
3 SASI_Hs01_00170375 predicted 953
4 SASI_Hs01_00170376 predicted 1086
5 SASI_Hs01_00170377 predicted 931
6 SASI_Hs01_00170378 predicted 883
7 SASI_Hs01_00170379 predicted 212
8 SASI_Hs01_00170380 predicted 915
9 SASI_Hs01_00170382 predicted 1454
10 SASI_Hs01_00170381 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116739 predicted 215
2 SASI_Rn01_00116740 predicted 297
3 SASI_Rn02_00199800 predicted 793
4 SASI_Rn01_00116741 predicted 1324
5 SASI_Rn01_00116742 predicted 1421
6 SASI_Rn01_00116745 predicted 198
7 SASI_Rn01_00116746 predicted 863
8 SASI_Rn01_00116747 predicted 214
9 SASI_Rn01_00116748 predicted 979
10 SASI_Rn02_00199801 predicted 1373
11 SASI_Rn01_00116743 predicted 1425
12 SASI_Rn01_00116744 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190275 predicted 449
2 SASI_Rn01_00190276 predicted 971
3 SASI_Rn01_00190277 predicted 444
4 SASI_Rn01_00190278 predicted 893
5 SASI_Rn01_00190279 predicted 293
6 SASI_Rn01_00190280 predicted 1036
7 SASI_Rn01_00190281 predicted 412
8 SASI_Rn01_00190282 predicted 972
9 SASI_Rn01_00190283 predicted 960
10 SASI_Rn01_00190284 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067527 predicted 731
2 SASI_Mm01_00067528 predicted 1175
3 SASI_Mm01_00067529 predicted 1148
4 SASI_Mm02_00334297 predicted 1435
5 SASI_Mm01_00067531 predicted 988
6 SASI_Mm02_00334298 predicted 1572
7 SASI_Mm01_00067532 predicted 735
8 SASI_Mm01_00067533 predicted 1077
9 SASI_Mm02_00334299 predicted 1308
10 SASI_Mm01_00067534 predicted 1115
11 SASI_Mm01_00067530 predicted 563
12 SASI_Mm01_00067535 predicted 1110
13 SASI_Mm01_00067536 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135653 predicted 605
2 SASI_Mm01_00135654 predicted 1043
3 SASI_Mm01_00135655 predicted 1016
4 SASI_Mm02_00336957 predicted 1299
5 SASI_Mm01_00135657 predicted 862
6 SASI_Mm02_00336958 predicted 1436
7 SASI_Mm01_00135658 predicted 605
8 SASI_Mm01_00135659 predicted 941
9 SASI_Mm02_00336959 predicted 1174
10 SASI_Mm01_00135660 predicted 976
11 SASI_Mm01_00135656 predicted 343
12 SASI_Mm01_00135661 predicted 893
13 SASI_Mm01_00135662 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028733
PACSIN3 MISSION shRNA Bacterial Glycerol Stock
protein kinase C and casein kinase substrate in neurons 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028733.1-1827s1c1
Sequence:CCGGCCTCGGGAACATTTGGGTCATCTCGAGATGACCCAAATGTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-740s1c1
Sequence:CCGGGCAGAGGATGGTTTCCGTAAACTCGAGTTTACGGAAACCATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-1587s1c1
Sequence:CCGGACCCTGCCAATTACGTAGAATCTCGAGATTCTACGTAATTGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-1320s1c1
Sequence:CCGGTGACCAGCATTGTACCGACAACTCGAGTTGTCGGTACAATGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-997s1c1
Sequence:CCGGCCCACGCTACATGGAGGACATCTCGAGATGTCCTCCATGTAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028733.3-739s21c1
Sequence:CCGGGCAGAGGATGGTTTCCGTAAACTCGAGTTTACGGAAACCATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028733.3-1586s21c1
Sequence:CCGGACCCTGCCAATTACGTAGAATCTCGAGATTCTACGTAATTGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028733.3-1826s21c1
Sequence:CCGGCCTCGGGAACATTTGGGTCATCTCGAGATGACCCAAATGTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028733
PACSIN3 MISSION shRNA shRNA Plasmid DNA
protein kinase C and casein kinase substrate in neurons 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028733.1-1827s1c1
Sequence:CCGGCCTCGGGAACATTTGGGTCATCTCGAGATGACCCAAATGTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-740s1c1
Sequence:CCGGGCAGAGGATGGTTTCCGTAAACTCGAGTTTACGGAAACCATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-1587s1c1
Sequence:CCGGACCCTGCCAATTACGTAGAATCTCGAGATTCTACGTAATTGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-1320s1c1
Sequence:CCGGTGACCAGCATTGTACCGACAACTCGAGTTGTCGGTACAATGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-997s1c1
Sequence:CCGGCCCACGCTACATGGAGGACATCTCGAGATGTCCTCCATGTAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028733.3-739s21c1
Sequence:CCGGGCAGAGGATGGTTTCCGTAAACTCGAGTTTACGGAAACCATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028733.3-1586s21c1
Sequence:CCGGACCCTGCCAATTACGTAGAATCTCGAGATTCTACGTAATTGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028733.3-1826s21c1
Sequence:CCGGCCTCGGGAACATTTGGGTCATCTCGAGATGACCCAAATGTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028733
PACSIN3 MISSION shRNA Lentiviral Transduction Particles
protein kinase C and casein kinase substrate in neurons 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028733.1-1827s1c1
Sequence:CCGGCCTCGGGAACATTTGGGTCATCTCGAGATGACCCAAATGTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-740s1c1
Sequence:CCGGGCAGAGGATGGTTTCCGTAAACTCGAGTTTACGGAAACCATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-1587s1c1
Sequence:CCGGACCCTGCCAATTACGTAGAATCTCGAGATTCTACGTAATTGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-1320s1c1
Sequence:CCGGTGACCAGCATTGTACCGACAACTCGAGTTGTCGGTACAATGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028733.1-997s1c1
Sequence:CCGGCCCACGCTACATGGAGGACATCTCGAGATGTCCTCCATGTAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028733.3-739s21c1
Sequence:CCGGGCAGAGGATGGTTTCCGTAAACTCGAGTTTACGGAAACCATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028733.3-1586s21c1
Sequence:CCGGACCCTGCCAATTACGTAGAATCTCGAGATTCTACGTAATTGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028733.3-1826s21c1
Sequence:CCGGCCTCGGGAACATTTGGGTCATCTCGAGATGACCCAAATGTTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016223
PACSIN3 MISSION shRNA Bacterial Glycerol Stock
protein kinase C and casein kinase substrate in neurons 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016223.3-1708s1c1
Sequence:CCGGTCAGTTCCTGACCTCTGCTTTCTCGAGAAAGCAGAGGTCAGGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-801s1c1
Sequence:CCGGGCATCGCTACACTCCACGCTACTCGAGTAGCGTGGAGTGTAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-1136s1c1
Sequence:CCGGTGACCAGCATTGTGCCTACAACTCGAGTTGTAGGCACAATGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-1210s1c1
Sequence:CCGGGATGAGGAGTGGTCAGATGAACTCGAGTTCATCTGACCACTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-931s1c1
Sequence:CCGGAGCAGTGAGAAGTTCCATGAACTCGAGTTCATGGAACTTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016223.3-1448s21c1
Sequence:CCGGAGCCCTTCTGCAACGTTTACCCTCGAGGGTAAACGTTGCAGAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016223.3-1656s21c1
Sequence:CCGGAGAGGTGACAGAAGCGTTCAGCTCGAGCTGAACGCTTCTGTCACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016223.3-890s21c1
Sequence:CCGGAGGATATGCTGCTCACCTTACCTCGAGGTAAGGTGAGCAGCATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016223
PACSIN3 MISSION shRNA shRNA Plasmid DNA
protein kinase C and casein kinase substrate in neurons 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016223.3-1708s1c1
Sequence:CCGGTCAGTTCCTGACCTCTGCTTTCTCGAGAAAGCAGAGGTCAGGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-801s1c1
Sequence:CCGGGCATCGCTACACTCCACGCTACTCGAGTAGCGTGGAGTGTAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-1136s1c1
Sequence:CCGGTGACCAGCATTGTGCCTACAACTCGAGTTGTAGGCACAATGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-1210s1c1
Sequence:CCGGGATGAGGAGTGGTCAGATGAACTCGAGTTCATCTGACCACTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-931s1c1
Sequence:CCGGAGCAGTGAGAAGTTCCATGAACTCGAGTTCATGGAACTTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016223.3-1448s21c1
Sequence:CCGGAGCCCTTCTGCAACGTTTACCCTCGAGGGTAAACGTTGCAGAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016223.3-1656s21c1
Sequence:CCGGAGAGGTGACAGAAGCGTTCAGCTCGAGCTGAACGCTTCTGTCACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016223.3-890s21c1
Sequence:CCGGAGGATATGCTGCTCACCTTACCTCGAGGTAAGGTGAGCAGCATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016223
PACSIN3 MISSION shRNA Lentiviral Transduction Particles
protein kinase C and casein kinase substrate in neurons 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016223.3-1708s1c1
Sequence:CCGGTCAGTTCCTGACCTCTGCTTTCTCGAGAAAGCAGAGGTCAGGAACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-801s1c1
Sequence:CCGGGCATCGCTACACTCCACGCTACTCGAGTAGCGTGGAGTGTAGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-1136s1c1
Sequence:CCGGTGACCAGCATTGTGCCTACAACTCGAGTTGTAGGCACAATGCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-1210s1c1
Sequence:CCGGGATGAGGAGTGGTCAGATGAACTCGAGTTCATCTGACCACTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016223.3-931s1c1
Sequence:CCGGAGCAGTGAGAAGTTCCATGAACTCGAGTTCATGGAACTTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016223.3-1448s21c1
Sequence:CCGGAGCCCTTCTGCAACGTTTACCCTCGAGGGTAAACGTTGCAGAAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016223.3-1656s21c1
Sequence:CCGGAGAGGTGACAGAAGCGTTCAGCTCGAGCTGAACGCTTCTGTCACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016223.3-890s21c1
Sequence:CCGGAGGATATGCTGCTCACCTTACCTCGAGGTAAGGTGAGCAGCATATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks