EMAIL THIS PAGE TO A FRIEND

PADI6

peptidyl arginine deiminase, type VI

Synonyms: hPADVI
UniProtKB ID: Q6TGC4, Q330K5, Q70SX3
Gene ID:
Human(353238) Summary: This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
Mouse(242726) peptidyl arginine deiminase, type VI
Rat(298595) peptidyl arginine deiminase, type VI
sheep(101107679) peptidyl arginine deiminase, type VI
domestic guinea pig(100735004) peptidyl arginine deiminase, type VI
naked mole-rat(101723122) peptidyl arginine deiminase, type VI
Domestic Rabbit(100350708) peptidyl arginine deiminase, type VI
cow(531084) peptidyl arginine deiminase, type VI
dog(487413) peptidyl arginine deiminase, type VI
Horse(100053017) peptidyl arginine deiminase, type VI
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207421 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207421 Rosetta Predictions human pricing
XM_001072099 Rosetta Predictions rat pricing
XM_233601 Rosetta Predictions rat pricing
NM_153106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043560 predicted 759
2 SASI_Hs01_00043561 predicted 1690
3 SASI_Hs01_00043562 predicted 381
4 SASI_Hs01_00043563 predicted 1592
5 SASI_Hs01_00043564 predicted 559
6 SASI_Hs01_00043565 predicted 648
7 SASI_Hs01_00043566 predicted 245
8 SASI_Hs01_00043567 predicted 768
9 SASI_Hs01_00043569 predicted 283
10 SASI_Hs02_00374060 predicted 841
11 SASI_Hs01_00043568 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337803 predicted 452
2 SASI_Rn02_00337804 predicted 1234
3 SASI_Rn02_00337805 predicted 1564
4 SASI_Rn02_00337806 predicted 1605
5 SASI_Rn02_00337807 predicted 1606
6 SASI_Rn02_00337808 predicted 617
7 SASI_Rn02_00337809 predicted 1421
8 SASI_Rn02_00337810 predicted 1420
9 SASI_Rn02_00337811 predicted 973
10 SASI_Rn02_00337812 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387907 predicted 449
2 SASI_Rn02_00387908 predicted 1229
3 SASI_Rn02_00387909 predicted 1558
4 SASI_Rn02_00387910 predicted 1604
5 SASI_Rn02_00387911 predicted 1605
6 SASI_Rn02_00387912 predicted 610
7 SASI_Rn02_00387913 predicted 1423
8 SASI_Rn02_00387914 predicted 1423
9 SASI_Rn02_00387915 predicted 971
10 SASI_Rn02_00387916 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076352 predicted 1124
2 SASI_Mm02_00342958 predicted 1038
3 SASI_Mm01_00076353 predicted 1142
4 SASI_Mm01_00076354 predicted 894
5 SASI_Mm01_00076356 predicted 1666
6 SASI_Mm01_00076357 predicted 936
7 SASI_Mm02_00342959 predicted 1695
8 SASI_Mm01_00076358 predicted 645
9 SASI_Mm01_00076359 predicted 2056
10 SASI_Mm01_00076360 predicted 1117
11 SASI_Mm01_00076351 predicted 432
12 SASI_Mm01_00076355 predicted 1677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207421
PADI6 MISSION shRNA Bacterial Glycerol Stock
peptidyl arginine deiminase, type VI
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-289s21c1
Sequence:CCGGGATAAGGTCTCGGTCACATACCTCGAGGTATGTGACCGAGACCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-1410s21c1
Sequence:CCGGGCTCTACTCAGATTGGCTAATCTCGAGATTAGCCAATCTGAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-176s21c1
Sequence:CCGGATGTGGCCAACACGGTGATTTCTCGAGAAATCACCGTGTTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-844s21c1
Sequence:CCGGGAGTCTCAAGACCCGTCAATTCTCGAGAATTGACGGGTCTTGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207421.3-2140s21c1
Sequence:CCGGATGCAACAGCATGATTCTTTGCTCGAGCAAAGAATCATGCTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207421.2-1158s1c1
Sequence:CCGGCCACAAGACAACGTCCTTGATCTCGAGATCAAGGACGTTGTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207421.2-1624s1c1
Sequence:CCGGGCTCTTCTGTTTGATGAGCTTCTCGAGAAGCTCATCAAACAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207421
PADI6 MISSION shRNA shRNA Plasmid DNA
peptidyl arginine deiminase, type VI
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-289s21c1
Sequence:CCGGGATAAGGTCTCGGTCACATACCTCGAGGTATGTGACCGAGACCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-1410s21c1
Sequence:CCGGGCTCTACTCAGATTGGCTAATCTCGAGATTAGCCAATCTGAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-176s21c1
Sequence:CCGGATGTGGCCAACACGGTGATTTCTCGAGAAATCACCGTGTTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-844s21c1
Sequence:CCGGGAGTCTCAAGACCCGTCAATTCTCGAGAATTGACGGGTCTTGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207421.3-2140s21c1
Sequence:CCGGATGCAACAGCATGATTCTTTGCTCGAGCAAAGAATCATGCTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207421.2-1158s1c1
Sequence:CCGGCCACAAGACAACGTCCTTGATCTCGAGATCAAGGACGTTGTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207421.2-1624s1c1
Sequence:CCGGGCTCTTCTGTTTGATGAGCTTCTCGAGAAGCTCATCAAACAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207421
PADI6 MISSION shRNA Lentiviral Transduction Particles
peptidyl arginine deiminase, type VI
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-289s21c1
Sequence:CCGGGATAAGGTCTCGGTCACATACCTCGAGGTATGTGACCGAGACCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-1410s21c1
Sequence:CCGGGCTCTACTCAGATTGGCTAATCTCGAGATTAGCCAATCTGAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-176s21c1
Sequence:CCGGATGTGGCCAACACGGTGATTTCTCGAGAAATCACCGTGTTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207421.3-844s21c1
Sequence:CCGGGAGTCTCAAGACCCGTCAATTCTCGAGAATTGACGGGTCTTGAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207421.3-2140s21c1
Sequence:CCGGATGCAACAGCATGATTCTTTGCTCGAGCAAAGAATCATGCTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207421.2-1158s1c1
Sequence:CCGGCCACAAGACAACGTCCTTGATCTCGAGATCAAGGACGTTGTCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207421.2-1624s1c1
Sequence:CCGGGCTCTTCTGTTTGATGAGCTTCTCGAGAAGCTCATCAAACAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153106
PADI6 MISSION shRNA Bacterial Glycerol Stock
peptidyl arginine deiminase, type VI
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000101776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-426s1c1
Sequence:CCGGGCCAAGTGATAAGCAAGCTAACTCGAGTTAGCTTGCTTATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-867s1c1
Sequence:CCGGCCCAGAGATTCCGCTCTATAACTCGAGTTATAGAGCGGAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-2037s1c1
Sequence:CCGGCATCATAAACAGGGTGCCATTCTCGAGAATGGCACCCTGTTTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-489s1c1
Sequence:CCGGGCTTGTGAATTGTAGCCCTAACTCGAGTTAGGGCTACAATTCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153106
PADI6 MISSION shRNA shRNA Plasmid DNA
peptidyl arginine deiminase, type VI
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000101776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-426s1c1
Sequence:CCGGGCCAAGTGATAAGCAAGCTAACTCGAGTTAGCTTGCTTATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-867s1c1
Sequence:CCGGCCCAGAGATTCCGCTCTATAACTCGAGTTATAGAGCGGAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-2037s1c1
Sequence:CCGGCATCATAAACAGGGTGCCATTCTCGAGAATGGCACCCTGTTTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-489s1c1
Sequence:CCGGGCTTGTGAATTGTAGCCCTAACTCGAGTTAGGGCTACAATTCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153106
PADI6 MISSION shRNA Lentiviral Transduction Particles
peptidyl arginine deiminase, type VI
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000101776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-426s1c1
Sequence:CCGGGCCAAGTGATAAGCAAGCTAACTCGAGTTAGCTTGCTTATCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-867s1c1
Sequence:CCGGCCCAGAGATTCCGCTCTATAACTCGAGTTATAGAGCGGAATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-2037s1c1
Sequence:CCGGCATCATAAACAGGGTGCCATTCTCGAGAATGGCACCCTGTTTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153106.1-489s1c1
Sequence:CCGGGCTTGTGAATTGTAGCCCTAACTCGAGTTAGGGCTACAATTCACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks