EMAIL THIS PAGE TO A FRIEND

PAFAH1B3

platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)

Synonyms: PAFAHG
UniProtKB ID: Q15102, Q53X88
Gene ID:
Human(5050) Summary: This gene encodes an acetylhydrolase that catalyzes the removal of an acetyl group from the glycerol backbone of platelet-activating factor. The encoded enzyme is a subunit of the platelet-activating factor acetylhydrolase isoform 1B complex, which consists of the catalytic beta and gamma subunits and the regulatory alpha subunit. This complex functions in brain development. A translocation between this gene on chromosome 19 and the CDC-like kinase 2 gene on chromosome 1 has been observed, and was associated with mental retardation, ataxia, and atrophy of the brain. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Mouse(18476) platelet-activating factor acetylhydrolase, isoform 1b, subunit 3
Rat(114113) platelet-activating factor acetylhydrolase 1b, catalytic subunit 3
domestic guinea pig(100735531) platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
naked mole-rat(101713250) platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
sheep(101102006) platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
Zebrafish(394033) platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit
domestic cat(101084667) platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
dog(476449) platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
cow(282515) platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002573 Rosetta Predictions human pricing
NM_053654 Rosetta Predictions rat pricing
NM_008776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182598 predicted 612
2 SASI_Hs01_00182599 predicted 606
3 SASI_Hs01_00182600 predicted 443
4 SASI_Hs01_00182601 predicted 425
5 SASI_Hs01_00182602 predicted 708
6 SASI_Hs01_00182603 predicted 607
7 SASI_Hs01_00182604 predicted 418
8 SASI_Hs01_00182605 predicted 595
9 SASI_Hs01_00182606 predicted 683
10 SASI_Hs01_00182607 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057958 predicted 409
2 SASI_Rn01_00057964 predicted 303
3 SASI_Rn01_00057965 predicted 534
4 SASI_Rn01_00057966 predicted 296
5 SASI_Rn02_00266378 predicted 404
6 SASI_Rn01_00057967 predicted 341
7 SASI_Rn02_00266379 predicted 246
8 SASI_Rn02_00266380 predicted 413
9 SASI_Rn02_00266381 predicted 330
10 SASI_Rn02_00266382 predicted 205
11 SASI_Rn01_00057959 predicted 276
12 SASI_Rn01_00057960 predicted 206
13 SASI_Rn01_00057961 predicted 505
14 SASI_Rn01_00057962 predicted 262
15 SASI_Rn01_00057963 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153109 predicted 471
2 SASI_Mm01_00153111 predicted 200
3 SASI_Mm02_00314666 predicted 340
4 SASI_Mm01_00153113 predicted 269
5 SASI_Mm01_00153114 predicted 232
6 SASI_Mm02_00314667 predicted 399
7 SASI_Mm01_00153115 predicted 487
8 SASI_Mm01_00153116 predicted 411
9 SASI_Mm02_00314668 predicted 318
10 SASI_Mm01_00153117 predicted 462
11 SASI_Mm01_00153110 predicted 324
12 SASI_Mm01_00153112 predicted 562
13 SASI_Mm01_00153118 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008776
VALIDATED
PAFAH1B3 MISSION shRNA Bacterial Glycerol Stock
platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008776.1-217s1c2
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008776.1-589s1c2
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-667s1c1
Sequence:CCGGGTGCATTCTGATGGCACCATACTCGAGTATGGTGCCATCAGAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-217s1c1
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-694s1c1
Sequence:CCGGCATGACATGTATGATTACCTACTCGAGTAGGTAATCATACATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-488s1c1
Sequence:CCGGCCATCGTACAACTGGTGAACACTCGAGTGTTCACCAGTTGTACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-589s1c1
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-217s21c1
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-694s21c1
Sequence:CCGGCATGACATGTATGATTACCTACTCGAGTAGGTAATCATACATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-589s21c1
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-488s21c1
Sequence:CCGGCCATCGTACAACTGGTGAACACTCGAGTGTTCACCAGTTGTACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008776
VALIDATED
PAFAH1B3 MISSION shRNA shRNA Plasmid DNA
platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008776.1-217s1c2
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008776.1-589s1c2
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-667s1c1
Sequence:CCGGGTGCATTCTGATGGCACCATACTCGAGTATGGTGCCATCAGAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-217s1c1
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-694s1c1
Sequence:CCGGCATGACATGTATGATTACCTACTCGAGTAGGTAATCATACATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-488s1c1
Sequence:CCGGCCATCGTACAACTGGTGAACACTCGAGTGTTCACCAGTTGTACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-589s1c1
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-217s21c1
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-694s21c1
Sequence:CCGGCATGACATGTATGATTACCTACTCGAGTAGGTAATCATACATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-589s21c1
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-488s21c1
Sequence:CCGGCCATCGTACAACTGGTGAACACTCGAGTGTTCACCAGTTGTACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008776
VALIDATED
PAFAH1B3 MISSION shRNA Lentiviral Transduction Particles
platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008776.1-217s1c2
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008776.1-589s1c2
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-667s1c1
Sequence:CCGGGTGCATTCTGATGGCACCATACTCGAGTATGGTGCCATCAGAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-217s1c1
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-694s1c1
Sequence:CCGGCATGACATGTATGATTACCTACTCGAGTAGGTAATCATACATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-488s1c1
Sequence:CCGGCCATCGTACAACTGGTGAACACTCGAGTGTTCACCAGTTGTACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008776.1-589s1c1
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-217s21c1
Sequence:CCGGCGGTTTGTAGCGGACAGCAAACTCGAGTTTGCTGTCCGCTACAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-694s21c1
Sequence:CCGGCATGACATGTATGATTACCTACTCGAGTAGGTAATCATACATGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-589s21c1
Sequence:CCGGCGACAGGTAAACGAGCTGGTTCTCGAGAACCAGCTCGTTTACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008776.1-488s21c1
Sequence:CCGGCCATCGTACAACTGGTGAACACTCGAGTGTTCACCAGTTGTACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002573
VALIDATED
PAFAH1B3 MISSION shRNA Bacterial Glycerol Stock
platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-806s1c1
Sequence:CCGGGATGGCACCATCAGCCATCATCTCGAGATGATGGCTGATGGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002573.2-361s1c1
Sequence:CCGGCAGCAAAGATAAGGAACCCGACTCGAGTCGGGTTCCTTATCTTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-719s1c1
Sequence:CCGGCGACAGGTGAACGAGCTGGTACTCGAGTACCAGCTCGTTCACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-595s1c1
Sequence:CCGGGCAGGTGACTGGTGGCATCAACTCGAGTTGATGCCACCAGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-458s1c1
Sequence:CCGGCATGCACTTAACTTTGGCATTCTCGAGAATGCCAAAGTTAAGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-487s21c1
Sequence:CCGGTCATGCACCAGTGCGAGATCTCTCGAGAGATCTCGCACTGGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-691s21c1
Sequence:CCGGCCATTGTGCAACTGGTGAATGCTCGAGCATTCACCAGTTGCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-792s21c1
Sequence:CCGGCGACAGGTGAACGAGCTGGTACTCGAGTACCAGCTCGTTCACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002573.3-879s21c1
Sequence:CCGGGATGGCACCATCAGCCATCATCTCGAGATGATGGCTGATGGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002573
VALIDATED
PAFAH1B3 MISSION shRNA shRNA Plasmid DNA
platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-806s1c1
Sequence:CCGGGATGGCACCATCAGCCATCATCTCGAGATGATGGCTGATGGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002573.2-361s1c1
Sequence:CCGGCAGCAAAGATAAGGAACCCGACTCGAGTCGGGTTCCTTATCTTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-719s1c1
Sequence:CCGGCGACAGGTGAACGAGCTGGTACTCGAGTACCAGCTCGTTCACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-595s1c1
Sequence:CCGGGCAGGTGACTGGTGGCATCAACTCGAGTTGATGCCACCAGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-458s1c1
Sequence:CCGGCATGCACTTAACTTTGGCATTCTCGAGAATGCCAAAGTTAAGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-487s21c1
Sequence:CCGGTCATGCACCAGTGCGAGATCTCTCGAGAGATCTCGCACTGGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-691s21c1
Sequence:CCGGCCATTGTGCAACTGGTGAATGCTCGAGCATTCACCAGTTGCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-792s21c1
Sequence:CCGGCGACAGGTGAACGAGCTGGTACTCGAGTACCAGCTCGTTCACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002573.3-879s21c1
Sequence:CCGGGATGGCACCATCAGCCATCATCTCGAGATGATGGCTGATGGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002573
VALIDATED
PAFAH1B3 MISSION shRNA Lentiviral Transduction Particles
platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-806s1c1
Sequence:CCGGGATGGCACCATCAGCCATCATCTCGAGATGATGGCTGATGGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002573.2-361s1c1
Sequence:CCGGCAGCAAAGATAAGGAACCCGACTCGAGTCGGGTTCCTTATCTTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-719s1c1
Sequence:CCGGCGACAGGTGAACGAGCTGGTACTCGAGTACCAGCTCGTTCACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-595s1c1
Sequence:CCGGGCAGGTGACTGGTGGCATCAACTCGAGTTGATGCCACCAGTCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002573.2-458s1c1
Sequence:CCGGCATGCACTTAACTTTGGCATTCTCGAGAATGCCAAAGTTAAGTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-487s21c1
Sequence:CCGGTCATGCACCAGTGCGAGATCTCTCGAGAGATCTCGCACTGGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-691s21c1
Sequence:CCGGCCATTGTGCAACTGGTGAATGCTCGAGCATTCACCAGTTGCACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002573.3-792s21c1
Sequence:CCGGCGACAGGTGAACGAGCTGGTACTCGAGTACCAGCTCGTTCACCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002573.3-879s21c1
Sequence:CCGGGATGGCACCATCAGCCATCATCTCGAGATGATGGCTGATGGTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks