EMAIL THIS PAGE TO A FRIEND

PAGE2B

P antigen family, member 2B

Synonyms: CT16.5 GAGEE3 PAGE-2B
Species: Human PAGE2B(389860)
UniProtKB ID: Q5JRK9, A1L414
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001015038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001015038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001015038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_372224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372224 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112191 MISSION® esiRNA esiRNA human PAGE2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015038 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097050 predicted 232
2 SASI_Hs01_00097051 predicted 231
3 SASI_Hs01_00097044 predicted 277
4 SASI_Hs01_00097045 predicted 244
5 SASI_Hs01_00097046 predicted 276
6 SASI_Hs01_00097047 predicted 279
7 SASI_Hs01_00097048 predicted 237
8 SASI_Hs01_00097049 predicted 266
9 SASI_Hs01_00097052 predicted 243
10 SASI_Hs01_00097053 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015038
PAGE2B MISSION shRNA Bacterial Glycerol Stock
P antigen family, member 2B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-116s1c1
Sequence:CCGGCAGCCAGTTGGATCTGTGATTCTCGAGAATCACAGATCCAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-118s1c1
Sequence:CCGGGCCAGTTGGATCTGTGATTGTCTCGAGACAATCACAGATCCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-164s1c1
Sequence:CCGGCAAGAAGAGGAACCACCAACTCTCGAGAGTTGGTGGTTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-272s1c1
Sequence:CCGGGAACTGGCTCTGCTTAAGATACTCGAGTATCTTAAGCAGAGCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-176s1c1
Sequence:CCGGCCACCAACTGATAATCAGGGTCTCGAGACCCTGATTATCAGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-79s1c1
Sequence:CCGGCCAATCCTCAGAAAGAGGAAACTCGAGTTTCCTCTTTCTGAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-284s1c1
Sequence:CCGGCTTAAGATAGAGGATGAGCCTCTCGAGAGGCTCATCCTCTATCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-187s21c1
Sequence:CCGGTAATCAGGGTATTGCACCTAGCTCGAGCTAGGTGCAATACCCTGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-171s21c1
Sequence:CCGGAGGAACCACCAACTGATAATCCTCGAGGATTATCAGTTGGTGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-94s21c1
Sequence:CCGGAGGAAATGACCAAGAGTCTTCCTCGAGGAAGACTCTTGGTCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-244s21c1
Sequence:CCGGAGGGCCTGACATGGAAGCTTTCTCGAGAAAGCTTCCATGTCAGGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015038
PAGE2B MISSION shRNA shRNA Plasmid DNA
P antigen family, member 2B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-116s1c1
Sequence:CCGGCAGCCAGTTGGATCTGTGATTCTCGAGAATCACAGATCCAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-118s1c1
Sequence:CCGGGCCAGTTGGATCTGTGATTGTCTCGAGACAATCACAGATCCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-164s1c1
Sequence:CCGGCAAGAAGAGGAACCACCAACTCTCGAGAGTTGGTGGTTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-272s1c1
Sequence:CCGGGAACTGGCTCTGCTTAAGATACTCGAGTATCTTAAGCAGAGCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-176s1c1
Sequence:CCGGCCACCAACTGATAATCAGGGTCTCGAGACCCTGATTATCAGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-79s1c1
Sequence:CCGGCCAATCCTCAGAAAGAGGAAACTCGAGTTTCCTCTTTCTGAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-284s1c1
Sequence:CCGGCTTAAGATAGAGGATGAGCCTCTCGAGAGGCTCATCCTCTATCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-187s21c1
Sequence:CCGGTAATCAGGGTATTGCACCTAGCTCGAGCTAGGTGCAATACCCTGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-171s21c1
Sequence:CCGGAGGAACCACCAACTGATAATCCTCGAGGATTATCAGTTGGTGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-94s21c1
Sequence:CCGGAGGAAATGACCAAGAGTCTTCCTCGAGGAAGACTCTTGGTCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-244s21c1
Sequence:CCGGAGGGCCTGACATGGAAGCTTTCTCGAGAAAGCTTCCATGTCAGGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015038
PAGE2B MISSION shRNA Lentiviral Transduction Particles
P antigen family, member 2B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166209    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-116s1c1
Sequence:CCGGCAGCCAGTTGGATCTGTGATTCTCGAGAATCACAGATCCAACTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-118s1c1
Sequence:CCGGGCCAGTTGGATCTGTGATTGTCTCGAGACAATCACAGATCCAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-164s1c1
Sequence:CCGGCAAGAAGAGGAACCACCAACTCTCGAGAGTTGGTGGTTCCTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-272s1c1
Sequence:CCGGGAACTGGCTCTGCTTAAGATACTCGAGTATCTTAAGCAGAGCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-176s1c1
Sequence:CCGGCCACCAACTGATAATCAGGGTCTCGAGACCCTGATTATCAGTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-79s1c1
Sequence:CCGGCCAATCCTCAGAAAGAGGAAACTCGAGTTTCCTCTTTCTGAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001015038.1-284s1c1
Sequence:CCGGCTTAAGATAGAGGATGAGCCTCTCGAGAGGCTCATCCTCTATCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-187s21c1
Sequence:CCGGTAATCAGGGTATTGCACCTAGCTCGAGCTAGGTGCAATACCCTGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-171s21c1
Sequence:CCGGAGGAACCACCAACTGATAATCCTCGAGGATTATCAGTTGGTGGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-94s21c1
Sequence:CCGGAGGAAATGACCAAGAGTCTTCCTCGAGGAAGACTCTTGGTCATTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001015038.1-244s21c1
Sequence:CCGGAGGGCCTGACATGGAAGCTTTCTCGAGAAAGCTTCCATGTCAGGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372224
PAGE2B MISSION shRNA Bacterial Glycerol Stock
P antigen family, member 2B
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000194309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372224.2-326s1c2
Sequence:CCGGGTGAGCATGTGAGAACAAGATCTCGAGATCTTGTTCTCACATGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372224
PAGE2B MISSION shRNA shRNA Plasmid DNA
P antigen family, member 2B
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000194309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372224.2-326s1c2
Sequence:CCGGGTGAGCATGTGAGAACAAGATCTCGAGATCTTGTTCTCACATGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372224
PAGE2B MISSION shRNA Lentiviral Transduction Particles
P antigen family, member 2B
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000194309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372224.2-326s1c2
Sequence:CCGGGTGAGCATGTGAGAACAAGATCTCGAGATCTTGTTCTCACATGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks