EMAIL THIS PAGE TO A FRIEND

PAGE3

P antigen family, member 3 (prostate associated)

Synonyms: CT16.6 GAGED1 PAGE-3
Species: Human PAGE3(139793)
UniProtKB ID: Q5JUK9, A5D6Y1
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017931 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017931 Rosetta Predictions human pricing
XM_001714623 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098406 predicted 433
2 SASI_Hs01_00098407 predicted 506
3 SASI_Hs01_00098408 predicted 516
4 SASI_Hs01_00098409 predicted 400
5 SASI_Hs01_00098410 predicted 400
6 SASI_Hs01_00098411 predicted 403
7 SASI_Hs01_00098412 predicted 304
8 SASI_Hs01_00098414 predicted 484
9 SASI_Hs01_00098415 predicted 444
10 SASI_Hs02_00306818 predicted 352
11 SASI_Hs01_00098413 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398323 predicted 347
2 SASI_Hs02_00398324 predicted 216
3 SASI_Hs02_00398325 predicted 346
4 SASI_Hs02_00398326 predicted 221
5 SASI_Hs02_00398327 predicted 291
6 SASI_Hs02_00398328 predicted 204
7 SASI_Hs02_00398329 predicted 213
8 SASI_Hs02_00398330 predicted 340
9 SASI_Hs02_00398331 predicted 340
10 SASI_Hs02_00398332 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017931
PAGE3 MISSION shRNA Bacterial Glycerol Stock
P antigen family, member 3 (prostate associated)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-571s1c1
Sequence:CCGGCCTAATGTCAAGGGAGAATTTCTCGAGAAATTCTCCCTTGACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-406s1c1
Sequence:CCGGCCCAGTAATGACCAGCTTCAACTCGAGTTGAAGCTGGTCATTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-361s1c1
Sequence:CCGGCAAGACTCTAATCATCCAGTACTCGAGTACTGGATGATTAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-556s1c1
Sequence:CCGGGAACGTGGAGATGGTCCTAATCTCGAGATTAGGACCATCTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-525s1c1
Sequence:CCGGCTGGGAACTGACTCGGTCAAACTCGAGTTTGACCGAGTCAGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017931
PAGE3 MISSION shRNA shRNA Plasmid DNA
P antigen family, member 3 (prostate associated)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-571s1c1
Sequence:CCGGCCTAATGTCAAGGGAGAATTTCTCGAGAAATTCTCCCTTGACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-406s1c1
Sequence:CCGGCCCAGTAATGACCAGCTTCAACTCGAGTTGAAGCTGGTCATTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-361s1c1
Sequence:CCGGCAAGACTCTAATCATCCAGTACTCGAGTACTGGATGATTAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-556s1c1
Sequence:CCGGGAACGTGGAGATGGTCCTAATCTCGAGATTAGGACCATCTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-525s1c1
Sequence:CCGGCTGGGAACTGACTCGGTCAAACTCGAGTTTGACCGAGTCAGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017931
PAGE3 MISSION shRNA Lentiviral Transduction Particles
P antigen family, member 3 (prostate associated)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-571s1c1
Sequence:CCGGCCTAATGTCAAGGGAGAATTTCTCGAGAAATTCTCCCTTGACATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-406s1c1
Sequence:CCGGCCCAGTAATGACCAGCTTCAACTCGAGTTGAAGCTGGTCATTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-361s1c1
Sequence:CCGGCAAGACTCTAATCATCCAGTACTCGAGTACTGGATGATTAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-556s1c1
Sequence:CCGGGAACGTGGAGATGGTCCTAATCTCGAGATTAGGACCATCTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017931.1-525s1c1
Sequence:CCGGCTGGGAACTGACTCGGTCAAACTCGAGTTTGACCGAGTCAGTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks