EMAIL THIS PAGE TO A FRIEND

PAGR1

PAXIP1 associated glutamate-rich protein 1

Synonyms: C16orf53 GAS PA1
UniProtKB ID: Q9BTK6, A2ICR6
Gene ID:
Human(79447) Summary: C16ORF53 (PA1) is a component of a Set1-like multiprotein histone methyltransferase complex (Cho et al., 2007 [PubMed 17500065]
Zebrafish(326076) PAXIP1 associated glutamate-rich protein 1
dog(489939) PAXIP1 associated glutamate-rich protein 1
cow(513650) chromosome 25 open reading frame, human C16orf53
domestic cat(101096866) PAXIP1 associated glutamate-rich protein 1
sheep(101119691) PAXIP1 associated glutamate-rich protein 1
naked mole-rat(101715743) PAXIP1 associated glutamate-rich protein 1
domestic guinea pig(100734854) PAXIP1 associated glutamate-rich protein 1
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024516 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028891 MISSION® esiRNA esiRNA human C16orf53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024516 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239715 predicted 843
2 SASI_Hs01_00239716 predicted 851
3 SASI_Hs02_00356791 predicted 1489
4 SASI_Hs02_00356792 predicted 1451
5 SASI_Hs02_00356793 predicted 1418
6 SASI_Hs01_00239713 predicted 683
7 SASI_Hs01_00239714 predicted 800
8 SASI_Hs02_00356794 predicted 1529
9 SASI_Hs02_00356795 predicted 1056
10 SASI_Hs02_00356796 predicted 475
11 SASI_Hs01_00239712 predicted 507
12 SASI_Hs01_00239717 predicted 630
13 SASI_Hs01_00239718 predicted 391
14 SASI_Hs01_00239719 predicted 539
15 SASI_Hs01_00239720 predicted 439
16 SASI_Hs01_00239721 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024516
VALIDATED
PAGR1 MISSION shRNA Bacterial Glycerol Stock
PAXIP1 associated glutamate-rich protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-634s1c1
Sequence:CCGGGACATGAAGAGACACAAGAAGCTCGAGCTTCTTGTGTCTCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-877s1c1
Sequence:CCGGGAGAAACCTCAAGCTCCCAAACTCGAGTTTGGGAGCTTGAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-632s1c1
Sequence:CCGGCGGACATGAAGAGACACAAGACTCGAGTCTTGTGTCTCTTCATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-502s1c1
Sequence:CCGGCACATGCCCACGGAATTTGATCTCGAGATCAAATTCCGTGGGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-476s1c1
Sequence:CCGGCCAAAGAAGAGGAAGAGGAAACTCGAGTTTCCTCTTCCTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-639s1c1
Sequence:CCGGGAAGAGACACAAGAAGCTGGACTCGAGTCCAGCTTCTTGTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024516.2-630s1c1
Sequence:CCGGGTCGGACATGAAGAGACACAACTCGAGTTGTGTCTCTTCATGTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-475s1c1
Sequence:CCGGGCCAAAGAAGAGGAAGAGGAACTCGAGTTCCTCTTCCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-346s1c1
Sequence:CCGGGAAATCCAGCGGCTCTATGAACTCGAGTTCATAGAGCCGCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-943s21c1
Sequence:CCGGGAAGAGACACAAGAAGCTGGACTCGAGTCCAGCTTCTTGTGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024516.3-1181s21c1
Sequence:CCGGGAGAAACCTCAAGCTCCCAAACTCGAGTTTGGGAGCTTGAGGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-806s21c1
Sequence:CCGGCACATGCCCACGGAATTTGATCTCGAGATCAAATTCCGTGGGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-934s21c1
Sequence:CCGGGTCGGACATGAAGAGACACAACTCGAGTTGTGTCTCTTCATGTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024516
VALIDATED
PAGR1 MISSION shRNA shRNA Plasmid DNA
PAXIP1 associated glutamate-rich protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-634s1c1
Sequence:CCGGGACATGAAGAGACACAAGAAGCTCGAGCTTCTTGTGTCTCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-877s1c1
Sequence:CCGGGAGAAACCTCAAGCTCCCAAACTCGAGTTTGGGAGCTTGAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-632s1c1
Sequence:CCGGCGGACATGAAGAGACACAAGACTCGAGTCTTGTGTCTCTTCATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-502s1c1
Sequence:CCGGCACATGCCCACGGAATTTGATCTCGAGATCAAATTCCGTGGGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-476s1c1
Sequence:CCGGCCAAAGAAGAGGAAGAGGAAACTCGAGTTTCCTCTTCCTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-639s1c1
Sequence:CCGGGAAGAGACACAAGAAGCTGGACTCGAGTCCAGCTTCTTGTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024516.2-630s1c1
Sequence:CCGGGTCGGACATGAAGAGACACAACTCGAGTTGTGTCTCTTCATGTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-475s1c1
Sequence:CCGGGCCAAAGAAGAGGAAGAGGAACTCGAGTTCCTCTTCCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-346s1c1
Sequence:CCGGGAAATCCAGCGGCTCTATGAACTCGAGTTCATAGAGCCGCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-943s21c1
Sequence:CCGGGAAGAGACACAAGAAGCTGGACTCGAGTCCAGCTTCTTGTGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024516.3-1181s21c1
Sequence:CCGGGAGAAACCTCAAGCTCCCAAACTCGAGTTTGGGAGCTTGAGGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-806s21c1
Sequence:CCGGCACATGCCCACGGAATTTGATCTCGAGATCAAATTCCGTGGGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-934s21c1
Sequence:CCGGGTCGGACATGAAGAGACACAACTCGAGTTGTGTCTCTTCATGTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024516
VALIDATED
PAGR1 MISSION shRNA Lentiviral Transduction Particles
PAXIP1 associated glutamate-rich protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-634s1c1
Sequence:CCGGGACATGAAGAGACACAAGAAGCTCGAGCTTCTTGTGTCTCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-877s1c1
Sequence:CCGGGAGAAACCTCAAGCTCCCAAACTCGAGTTTGGGAGCTTGAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-632s1c1
Sequence:CCGGCGGACATGAAGAGACACAAGACTCGAGTCTTGTGTCTCTTCATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-502s1c1
Sequence:CCGGCACATGCCCACGGAATTTGATCTCGAGATCAAATTCCGTGGGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-476s1c1
Sequence:CCGGCCAAAGAAGAGGAAGAGGAAACTCGAGTTTCCTCTTCCTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-639s1c1
Sequence:CCGGGAAGAGACACAAGAAGCTGGACTCGAGTCCAGCTTCTTGTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024516.2-630s1c1
Sequence:CCGGGTCGGACATGAAGAGACACAACTCGAGTTGTGTCTCTTCATGTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024516.2-475s1c1
Sequence:CCGGGCCAAAGAAGAGGAAGAGGAACTCGAGTTCCTCTTCCTCTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024516.2-346s1c1
Sequence:CCGGGAAATCCAGCGGCTCTATGAACTCGAGTTCATAGAGCCGCTGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-943s21c1
Sequence:CCGGGAAGAGACACAAGAAGCTGGACTCGAGTCCAGCTTCTTGTGTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024516.3-1181s21c1
Sequence:CCGGGAGAAACCTCAAGCTCCCAAACTCGAGTTTGGGAGCTTGAGGTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-806s21c1
Sequence:CCGGCACATGCCCACGGAATTTGATCTCGAGATCAAATTCCGTGGGCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024516.3-934s21c1
Sequence:CCGGGTCGGACATGAAGAGACACAACTCGAGTTGTGTCTCTTCATGTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks