EMAIL THIS PAGE TO A FRIEND

PAIP1

poly(A) binding protein interacting protein 1

UniProtKB ID: Q9H074, A6NKV8, O60455, Q96B61, Q9BS63
Gene ID:
Human(10605) Summary: The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(218693) polyadenylate binding protein-interacting protein 1
Rat(365684) poly(A) binding protein interacting protein 1
domestic guinea pig(100732845) poly(A) binding protein interacting protein 1
naked mole-rat(101709498) poly(A) binding protein interacting protein 1
sheep(101122055) poly(A) binding protein interacting protein 1
Zebrafish(445110) poly(A) binding protein interacting protein 1
chicken(427195) poly(A) binding protein interacting protein 1
cow(510246) poly(A) binding protein interacting protein 1
dog(479343) poly(A) binding protein interacting protein 1
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006451 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006451 Rosetta Predictions human pricing
NM_182789 Rosetta Predictions human pricing
NM_183323 Rosetta Predictions human pricing
NM_001108937 Rosetta Predictions rat pricing
NM_001079849 Rosetta Predictions mouse pricing
NM_145457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091717 predicted 1705
2 SASI_Hs01_00091718 predicted 1166
3 SASI_Hs01_00091719 predicted 920
4 SASI_Hs01_00091720 predicted 1582
5 SASI_Hs01_00091721 predicted 1425
6 SASI_Hs01_00091722 predicted 1413
7 SASI_Hs01_00091723 predicted 1103
8 SASI_Hs01_00091724 predicted 1646
9 SASI_Hs01_00091725 predicted 847
10 SASI_Hs01_00091726 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230522 predicted 1467
2 SASI_Hs01_00230523 predicted 927
3 SASI_Hs01_00230524 predicted 683
4 SASI_Hs01_00230525 predicted 1337
5 SASI_Hs01_00230526 predicted 1189
6 SASI_Hs01_00230527 predicted 1175
7 SASI_Hs01_00230528 predicted 864
8 SASI_Hs01_00230529 predicted 1410
9 SASI_Hs01_00230530 predicted 616
10 SASI_Hs01_00230531 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178915 predicted 1243
2 SASI_Hs01_00178916 predicted 705
3 SASI_Hs01_00178917 predicted 464
4 SASI_Hs01_00178918 predicted 1117
5 SASI_Hs01_00178919 predicted 969
6 SASI_Hs01_00178920 predicted 958
7 SASI_Hs01_00178921 predicted 638
8 SASI_Hs01_00178922 predicted 1190
9 SASI_Hs01_00178923 predicted 392
10 SASI_Hs01_00178924 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243554 predicted 824
2 SASI_Rn02_00243555 predicted 840
3 SASI_Rn02_00243556 predicted 458
4 SASI_Rn02_00243557 predicted 258
5 SASI_Rn02_00243558 predicted 364
6 SASI_Rn02_00243559 predicted 608
7 SASI_Rn02_00243560 predicted 808
8 SASI_Rn02_00243561 predicted 380
9 SASI_Rn02_00243562 predicted 1004
10 SASI_Rn02_00243563 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293122 predicted 955
2 SASI_Mm02_00293123 predicted 274
3 SASI_Mm02_00293124 predicted 331
4 SASI_Mm02_00293125 predicted 451
5 SASI_Mm02_00293126 predicted 330
6 SASI_Mm02_00293127 predicted 476
7 SASI_Mm02_00293128 predicted 440
8 SASI_Mm02_00293129 predicted 247
9 SASI_Mm02_00293130 predicted 961
10 SASI_Mm02_00293131 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340846 predicted 1166
2 SASI_Mm01_00199667 predicted 490
3 SASI_Mm01_00199668 predicted 546
4 SASI_Mm01_00199669 predicted 668
5 SASI_Mm01_00199670 predicted 546
6 SASI_Mm01_00199671 predicted 686
7 SASI_Mm02_00340847 predicted 653
8 SASI_Mm01_00199672 predicted 464
9 SASI_Mm02_00340848 predicted 1179
10 SASI_Mm01_00199673 predicted 559
11 SASI_Mm01_00199674 predicted 521
12 SASI_Mm01_00199675 predicted 1053
13 SASI_Mm01_00199676 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145457
VALIDATED
PAIP1 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein interacting protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-240s1c1
Sequence:CCGGCCACCTAGTTCACAGGATAAACTCGAGTTTATCCTGTGAACTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1095s1c1
Sequence:CCGGGCAACTTCAACATACAGAGAACTCGAGTTCTCTGTATGTTGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1468s1c1
Sequence:CCGGGCAAGAAACTGTGTCAGACTTCTCGAGAAGTCTGACACAGTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-359s1c1
Sequence:CCGGCCCATCAGGTTATTCTTCTAACTCGAGTTAGAAGAATAACCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1447s1c1
Sequence:CCGGGATTTAGAAGAACACAGGAAACTCGAGTTTCCTGTGTTCTTCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-397s21c1
Sequence:CCGGCCCATCAGGTTATTCTTCTAACTCGAGTTAGAAGAATAACCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-1500s21c1
Sequence:CCGGGATTTAGAAGAACACAGGAAACTCGAGTTTCCTGTGTTCTTCTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-1521s21c1
Sequence:CCGGGCAAGAAACTGTGTCAGACTTCTCGAGAAGTCTGACACAGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-278s21c1
Sequence:CCGGCCACCTAGTTCACAGGATAAACTCGAGTTTATCCTGTGAACTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145457.3-1133s21c1
Sequence:CCGGGCAACTTCAACATACAGAGAACTCGAGTTCTCTGTATGTTGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145457
VALIDATED
PAIP1 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein interacting protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-240s1c1
Sequence:CCGGCCACCTAGTTCACAGGATAAACTCGAGTTTATCCTGTGAACTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1095s1c1
Sequence:CCGGGCAACTTCAACATACAGAGAACTCGAGTTCTCTGTATGTTGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1468s1c1
Sequence:CCGGGCAAGAAACTGTGTCAGACTTCTCGAGAAGTCTGACACAGTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-359s1c1
Sequence:CCGGCCCATCAGGTTATTCTTCTAACTCGAGTTAGAAGAATAACCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1447s1c1
Sequence:CCGGGATTTAGAAGAACACAGGAAACTCGAGTTTCCTGTGTTCTTCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-397s21c1
Sequence:CCGGCCCATCAGGTTATTCTTCTAACTCGAGTTAGAAGAATAACCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-1500s21c1
Sequence:CCGGGATTTAGAAGAACACAGGAAACTCGAGTTTCCTGTGTTCTTCTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-1521s21c1
Sequence:CCGGGCAAGAAACTGTGTCAGACTTCTCGAGAAGTCTGACACAGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-278s21c1
Sequence:CCGGCCACCTAGTTCACAGGATAAACTCGAGTTTATCCTGTGAACTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145457.3-1133s21c1
Sequence:CCGGGCAACTTCAACATACAGAGAACTCGAGTTCTCTGTATGTTGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145457
VALIDATED
PAIP1 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein interacting protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-240s1c1
Sequence:CCGGCCACCTAGTTCACAGGATAAACTCGAGTTTATCCTGTGAACTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1095s1c1
Sequence:CCGGGCAACTTCAACATACAGAGAACTCGAGTTCTCTGTATGTTGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1468s1c1
Sequence:CCGGGCAAGAAACTGTGTCAGACTTCTCGAGAAGTCTGACACAGTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-359s1c1
Sequence:CCGGCCCATCAGGTTATTCTTCTAACTCGAGTTAGAAGAATAACCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145457.2-1447s1c1
Sequence:CCGGGATTTAGAAGAACACAGGAAACTCGAGTTTCCTGTGTTCTTCTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-397s21c1
Sequence:CCGGCCCATCAGGTTATTCTTCTAACTCGAGTTAGAAGAATAACCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-1500s21c1
Sequence:CCGGGATTTAGAAGAACACAGGAAACTCGAGTTTCCTGTGTTCTTCTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-1521s21c1
Sequence:CCGGGCAAGAAACTGTGTCAGACTTCTCGAGAAGTCTGACACAGTTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145457.3-278s21c1
Sequence:CCGGCCACCTAGTTCACAGGATAAACTCGAGTTTATCCTGTGAACTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145457.3-1133s21c1
Sequence:CCGGGCAACTTCAACATACAGAGAACTCGAGTTCTCTGTATGTTGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006451
VALIDATED
PAIP1 MISSION shRNA Bacterial Glycerol Stock
poly(A) binding protein interacting protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006451.3-914s1c1
Sequence:CCGGCCTGTCCCATCATCTGACAATCTCGAGATTGTCAGATGATGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006451.3-1146s1c1
Sequence:CCGGGAATTGCTGAATGCCCTGTTTCTCGAGAAACAGGGCATTCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-2209s1c1
Sequence:CCGGGCTATTTGATACCAAGGGCTTCTCGAGAAGCCCTTGGTATCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-1968s1c1
Sequence:CCGGGCTAGTTGGTTAGATGCTTATCTCGAGATAAGCATCTAACCAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-2283s1c1
Sequence:CCGGCCAAGACTTCACTGAAGATTTCTCGAGAAATCTTCAGTGAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006451.3-1378s1c1
Sequence:CCGGGAGTCCATGCAACTTCAACATCTCGAGATGTTGAAGTTGCATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006451.3-1128s1c1
Sequence:CCGGCTTCAGGTTGGTCTTCGAGAACTCGAGTTCTCGAAGACCAACCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006451.4-1978s21c1
Sequence:CCGGGGTTAGATGCTTATCCTTTAACTCGAGTTAAAGGATAAGCATCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006451.4-1151s21c1
Sequence:CCGGGAATTGCTGAATGCCCTGTTTCTCGAGAAACAGGGCATTCAGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006451.4-693s21c1
Sequence:CCGGAGGATGGTTGTGAGGATTATCCTCGAGGATAATCCTCACAACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006451.4-1133s21c1
Sequence:CCGGCTTCAGGTTGGTCTTCGAGAACTCGAGTTCTCGAAGACCAACCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006451
VALIDATED
PAIP1 MISSION shRNA shRNA Plasmid DNA
poly(A) binding protein interacting protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006451.3-914s1c1
Sequence:CCGGCCTGTCCCATCATCTGACAATCTCGAGATTGTCAGATGATGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006451.3-1146s1c1
Sequence:CCGGGAATTGCTGAATGCCCTGTTTCTCGAGAAACAGGGCATTCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-2209s1c1
Sequence:CCGGGCTATTTGATACCAAGGGCTTCTCGAGAAGCCCTTGGTATCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-1968s1c1
Sequence:CCGGGCTAGTTGGTTAGATGCTTATCTCGAGATAAGCATCTAACCAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-2283s1c1
Sequence:CCGGCCAAGACTTCACTGAAGATTTCTCGAGAAATCTTCAGTGAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006451.3-1378s1c1
Sequence:CCGGGAGTCCATGCAACTTCAACATCTCGAGATGTTGAAGTTGCATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006451.3-1128s1c1
Sequence:CCGGCTTCAGGTTGGTCTTCGAGAACTCGAGTTCTCGAAGACCAACCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006451.4-1978s21c1
Sequence:CCGGGGTTAGATGCTTATCCTTTAACTCGAGTTAAAGGATAAGCATCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006451.4-1151s21c1
Sequence:CCGGGAATTGCTGAATGCCCTGTTTCTCGAGAAACAGGGCATTCAGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006451.4-693s21c1
Sequence:CCGGAGGATGGTTGTGAGGATTATCCTCGAGGATAATCCTCACAACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006451.4-1133s21c1
Sequence:CCGGCTTCAGGTTGGTCTTCGAGAACTCGAGTTCTCGAAGACCAACCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006451
VALIDATED
PAIP1 MISSION shRNA Lentiviral Transduction Particles
poly(A) binding protein interacting protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006451.3-914s1c1
Sequence:CCGGCCTGTCCCATCATCTGACAATCTCGAGATTGTCAGATGATGGGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006451.3-1146s1c1
Sequence:CCGGGAATTGCTGAATGCCCTGTTTCTCGAGAAACAGGGCATTCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127832    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-2209s1c1
Sequence:CCGGGCTATTTGATACCAAGGGCTTCTCGAGAAGCCCTTGGTATCAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-1968s1c1
Sequence:CCGGGCTAGTTGGTTAGATGCTTATCTCGAGATAAGCATCTAACCAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006451.3-2283s1c1
Sequence:CCGGCCAAGACTTCACTGAAGATTTCTCGAGAAATCTTCAGTGAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006451.3-1378s1c1
Sequence:CCGGGAGTCCATGCAACTTCAACATCTCGAGATGTTGAAGTTGCATGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006451.3-1128s1c1
Sequence:CCGGCTTCAGGTTGGTCTTCGAGAACTCGAGTTCTCGAAGACCAACCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006451.4-1978s21c1
Sequence:CCGGGGTTAGATGCTTATCCTTTAACTCGAGTTAAAGGATAAGCATCTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006451.4-1151s21c1
Sequence:CCGGGAATTGCTGAATGCCCTGTTTCTCGAGAAACAGGGCATTCAGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006451.4-693s21c1
Sequence:CCGGAGGATGGTTGTGAGGATTATCCTCGAGGATAATCCTCACAACCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006451.4-1133s21c1
Sequence:CCGGCTTCAGGTTGGTCTTCGAGAACTCGAGTTCTCGAAGACCAACCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks