EMAIL THIS PAGE TO A FRIEND

PAPD7

PAP associated domain containing 7

Synonyms: LAK-1 LAK1 POLK POLS TRF4 TRF4-1 TRF41 TUTASE5
UniProtKB ID: Q5XG87, A8K1E2, O43289, Q17RZ1, Q9Y6C1
Gene ID:
Human(11044) Summary: The protein encoded by this gene is a DNA polymerase that is likely involved in DNA repair. In addition, the encoded protein may be required for sister chromatid adhesion. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jan 2010]
Mouse(210106) PAP associated domain containing 7
Rat(306672) PAP associated domain containing 7
Zebrafish(557829) PAP associated domain containing 7
Horse(100071429) PAP associated domain containing 7
cow(523016) PAP associated domain containing 7
domestic cat(101094571) PAP associated domain containing 7
dog(488057) PAP associated domain containing 7
chicken(770425) PAP associated domain containing 7
domestic guinea pig(100713708) PAP associated domain containing 7
naked mole-rat(101716019) PAP associated domain containing 7
Domestic Rabbit(100350123) PAP associated domain containing 7
sheep(101106461) PAP associated domain containing 7
156 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006999 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006999 Rosetta Predictions human pricing
NM_001107333 Rosetta Predictions rat pricing
NM_198600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118586 predicted 956
2 SASI_Hs01_00118587 predicted 383
3 SASI_Hs01_00118588 predicted 1387
4 SASI_Hs01_00118590 predicted 1477
5 SASI_Hs01_00118591 predicted 728
6 SASI_Hs01_00118592 predicted 607
7 SASI_Hs01_00118593 predicted 880
8 SASI_Hs01_00118594 predicted 356
9 SASI_Hs02_00342747 predicted 897
10 SASI_Hs01_00118595 predicted 1463
11 SASI_Hs01_00118589 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227805 predicted 478
2 SASI_Rn02_00227806 predicted 1607
3 SASI_Rn02_00227807 predicted 1646
4 SASI_Rn02_00227808 predicted 960
5 SASI_Rn02_00227809 predicted 1552
6 SASI_Rn02_00227810 predicted 1350
7 SASI_Rn02_00227811 predicted 1475
8 SASI_Rn02_00227812 predicted 453
9 SASI_Rn02_00227813 predicted 340
10 SASI_Rn02_00227814 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103841 predicted 520
2 SASI_Mm01_00103843 predicted 1790
3 SASI_Mm01_00103844 predicted 1821
4 SASI_Mm01_00103845 predicted 1525
5 SASI_Mm01_00103846 predicted 1133
6 SASI_Mm02_00351000 predicted 561
7 SASI_Mm01_00103847 predicted 513
8 SASI_Mm01_00103848 predicted 444
9 SASI_Mm01_00103849 predicted 478
10 SASI_Mm01_00103850 predicted 677
11 SASI_Mm01_00103842 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006999
VALIDATED
PAPD7 MISSION shRNA Bacterial Glycerol Stock
PAP associated domain containing 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-141s1c1
Sequence:CCGGGCAGCTTTAGTACAGGTCTTTCTCGAGAAAGACCTGTACTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006999.2-1449s1c1
Sequence:CCGGCGAGCCCTCATCTGTATCATACTCGAGTATGATACAGATGAGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-86s1c1
Sequence:CCGGCGGATCGAAACTGTGGTGAAACTCGAGTTTCACCACAGTTTCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-263s1c1
Sequence:CCGGCCGTGTTCCATCAAAGTCCTTCTCGAGAAGGACTTTGATGGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006999.2-1296s1c1
Sequence:CCGGCCAACAATCAGACCAGGTTTACTCGAGTAAACCTGGTCTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-1007s21c1
Sequence:CCGGACTACCGGAGGTGGATCAAAGCTCGAGCTTTGATCCACCTCCGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-211s21c1
Sequence:CCGGACGGCTGATGTACAGATATTTCTCGAGAAATATCTGTACATCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-275s21c1
Sequence:CCGGACCTGGTGGTCTTCGGGAAATCTCGAGATTTCCCGAAGACCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-581s21c1
Sequence:CCGGTTAGCTCATACAGCCTAATTTCTCGAGAAATTAGGCTGTATGAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006999
VALIDATED
PAPD7 MISSION shRNA shRNA Plasmid DNA
PAP associated domain containing 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-141s1c1
Sequence:CCGGGCAGCTTTAGTACAGGTCTTTCTCGAGAAAGACCTGTACTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006999.2-1449s1c1
Sequence:CCGGCGAGCCCTCATCTGTATCATACTCGAGTATGATACAGATGAGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-86s1c1
Sequence:CCGGCGGATCGAAACTGTGGTGAAACTCGAGTTTCACCACAGTTTCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-263s1c1
Sequence:CCGGCCGTGTTCCATCAAAGTCCTTCTCGAGAAGGACTTTGATGGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006999.2-1296s1c1
Sequence:CCGGCCAACAATCAGACCAGGTTTACTCGAGTAAACCTGGTCTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-1007s21c1
Sequence:CCGGACTACCGGAGGTGGATCAAAGCTCGAGCTTTGATCCACCTCCGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-211s21c1
Sequence:CCGGACGGCTGATGTACAGATATTTCTCGAGAAATATCTGTACATCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-275s21c1
Sequence:CCGGACCTGGTGGTCTTCGGGAAATCTCGAGATTTCCCGAAGACCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-581s21c1
Sequence:CCGGTTAGCTCATACAGCCTAATTTCTCGAGAAATTAGGCTGTATGAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006999
VALIDATED
PAPD7 MISSION shRNA Lentiviral Transduction Particles
PAP associated domain containing 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-141s1c1
Sequence:CCGGGCAGCTTTAGTACAGGTCTTTCTCGAGAAAGACCTGTACTAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006999.2-1449s1c1
Sequence:CCGGCGAGCCCTCATCTGTATCATACTCGAGTATGATACAGATGAGGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-86s1c1
Sequence:CCGGCGGATCGAAACTGTGGTGAAACTCGAGTTTCACCACAGTTTCGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006999.2-263s1c1
Sequence:CCGGCCGTGTTCCATCAAAGTCCTTCTCGAGAAGGACTTTGATGGAACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006999.2-1296s1c1
Sequence:CCGGCCAACAATCAGACCAGGTTTACTCGAGTAAACCTGGTCTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-1007s21c1
Sequence:CCGGACTACCGGAGGTGGATCAAAGCTCGAGCTTTGATCCACCTCCGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-211s21c1
Sequence:CCGGACGGCTGATGTACAGATATTTCTCGAGAAATATCTGTACATCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-275s21c1
Sequence:CCGGACCTGGTGGTCTTCGGGAAATCTCGAGATTTCCCGAAGACCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006999.3-581s21c1
Sequence:CCGGTTAGCTCATACAGCCTAATTTCTCGAGAAATTAGGCTGTATGAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198600
VALIDATED
PAPD7 MISSION shRNA Bacterial Glycerol Stock
PAP associated domain containing 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1319s1c1
Sequence:CCGGCCTTGACAACAGGATTAAGATCTCGAGATCTTAATCCTGTTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1143s1c1
Sequence:CCGGGTGTTTGACTACGCTTACATTCTCGAGAATGTAAGCGTAGTCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-612s1c1
Sequence:CCGGCCGTGCTCCATCAAAGTTCTTCTCGAGAAGAACTTTGATGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1738s1c1
Sequence:CCGGTGAAGGCTGTTCACAGTGTAACTCGAGTTACACTGTGAACAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-564s1c1
Sequence:CCGGCCATTACAGTTGTTGGAACAACTCGAGTTGTTCCAACAACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198600
VALIDATED
PAPD7 MISSION shRNA shRNA Plasmid DNA
PAP associated domain containing 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1319s1c1
Sequence:CCGGCCTTGACAACAGGATTAAGATCTCGAGATCTTAATCCTGTTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1143s1c1
Sequence:CCGGGTGTTTGACTACGCTTACATTCTCGAGAATGTAAGCGTAGTCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-612s1c1
Sequence:CCGGCCGTGCTCCATCAAAGTTCTTCTCGAGAAGAACTTTGATGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1738s1c1
Sequence:CCGGTGAAGGCTGTTCACAGTGTAACTCGAGTTACACTGTGAACAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-564s1c1
Sequence:CCGGCCATTACAGTTGTTGGAACAACTCGAGTTGTTCCAACAACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198600
VALIDATED
PAPD7 MISSION shRNA Lentiviral Transduction Particles
PAP associated domain containing 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1319s1c1
Sequence:CCGGCCTTGACAACAGGATTAAGATCTCGAGATCTTAATCCTGTTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1143s1c1
Sequence:CCGGGTGTTTGACTACGCTTACATTCTCGAGAATGTAAGCGTAGTCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-612s1c1
Sequence:CCGGCCGTGCTCCATCAAAGTTCTTCTCGAGAAGAACTTTGATGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-1738s1c1
Sequence:CCGGTGAAGGCTGTTCACAGTGTAACTCGAGTTACACTGTGAACAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198600.1-564s1c1
Sequence:CCGGCCATTACAGTTGTTGGAACAACTCGAGTTGTTCCAACAACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks