EMAIL THIS PAGE TO A FRIEND

PAPSS2

3'-phosphoadenosine 5'-phosphosulfate synthase 2

Synonyms: ATPSK2 BCYM4 SK2
UniProtKB ID: O95340, Q9BZL2, Q9P0G6, Q9UHM1, Q9UKD3, Q9UP30
Gene ID:
Human(9060) Summary: Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(23972) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Rat(294103) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
domestic guinea pig(100379231) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
naked mole-rat(101712205) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
sheep(101122238) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
chicken(423678) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
dog(486463) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
domestic cat(101097918) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
cow(536409) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Horse(100071740) 3'-phosphoadenosine 5'-phosphosulfate synthase 2
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004670 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079661 MISSION® esiRNA esiRNA human PAPSS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015880 Rosetta Predictions human pricing
NM_004670 Rosetta Predictions human pricing
NM_001106375 Rosetta Predictions rat pricing
NM_011864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033932 predicted 709
2 SASI_Hs01_00033933 predicted 899
3 SASI_Hs01_00033934 predicted 1775
4 SASI_Hs01_00033935 predicted 1910
5 SASI_Hs01_00033937 predicted 699
6 SASI_Hs01_00033938 predicted 1474
7 SASI_Hs01_00033939 predicted 1994
8 SASI_Hs01_00033940 predicted 779
9 SASI_Hs01_00033941 predicted 1842
10 SASI_Hs02_00306667 predicted 1424
11 SASI_Hs01_00033936 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113965 predicted 704
2 SASI_Hs01_00113966 predicted 901
3 SASI_Hs01_00113967 predicted 1755
4 SASI_Hs01_00113968 predicted 1890
5 SASI_Hs01_00113970 predicted 695
6 SASI_Hs01_00113971 predicted 1461
7 SASI_Hs01_00113972 predicted 1984
8 SASI_Hs01_00113973 predicted 781
9 SASI_Hs01_00113974 predicted 1824
10 SASI_Hs02_00338096 predicted 1412
11 SASI_Hs01_00113969 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218348 predicted 1623
2 SASI_Rn02_00218349 predicted 480
3 SASI_Rn02_00218350 predicted 1842
4 SASI_Rn02_00218351 predicted 1665
5 SASI_Rn02_00218352 predicted 469
6 SASI_Rn02_00218353 predicted 213
7 SASI_Rn02_00218354 predicted 1484
8 SASI_Rn02_00218355 predicted 373
9 SASI_Rn02_00218356 predicted 569
10 SASI_Rn02_00218357 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128469 predicted 1616
2 SASI_Mm01_00128471 predicted 1789
3 SASI_Mm02_00321636 predicted 592
4 SASI_Mm01_00128472 predicted 1795
5 SASI_Mm01_00128473 predicted 809
6 SASI_Mm01_00128474 predicted 1645
7 SASI_Mm01_00128475 predicted 327
8 SASI_Mm01_00128476 predicted 1036
9 SASI_Mm01_00128477 predicted 1365
10 SASI_Mm02_00321637 predicted 1723
11 SASI_Mm01_00128468 predicted 274
12 SASI_Mm01_00128470 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011864
VALIDATED
PAPSS2 MISSION shRNA Bacterial Glycerol Stock
3'-phosphoadenosine 5'-phosphosulfate synthase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-1965s21c1
Sequence:CCGGGCGTGGAAAGTGTTGACAGATCTCGAGATCTGTCAACACTTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-218s21c1
Sequence:CCGGCCATCATGTGAGCAGGAACAACTCGAGTTGTTCCTGCTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-657s21c1
Sequence:CCGGGCAGGAGAGATTAAAGGGTTTCTCGAGAAACCCTTTAATCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-333s21c1
Sequence:CCGGGCTTTGGAAGAGTACCTTGTACTCGAGTACAAGGTACTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-3026s1c1
Sequence:CCGGGCGTGGAAAGTGTTGACAGATCTCGAGATCTGTCAACACTTTCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-2204s1c1
Sequence:CCGGGCTCTATTACAGGACCCTGAACTCGAGTTCAGGGTCCTGTAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1394s1c1
Sequence:CCGGGCTTTGGAAGAGTACCTTGTACTCGAGTACAAGGTACTCTTCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1279s1c1
Sequence:CCGGCCATCATGTGAGCAGGAACAACTCGAGTTGTTCCTGCTCACATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1718s1c1
Sequence:CCGGGCAGGAGAGATTAAAGGGTTTCTCGAGAAACCCTTTAATCTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011864
VALIDATED
PAPSS2 MISSION shRNA shRNA Plasmid DNA
3'-phosphoadenosine 5'-phosphosulfate synthase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-1965s21c1
Sequence:CCGGGCGTGGAAAGTGTTGACAGATCTCGAGATCTGTCAACACTTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-218s21c1
Sequence:CCGGCCATCATGTGAGCAGGAACAACTCGAGTTGTTCCTGCTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-657s21c1
Sequence:CCGGGCAGGAGAGATTAAAGGGTTTCTCGAGAAACCCTTTAATCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-333s21c1
Sequence:CCGGGCTTTGGAAGAGTACCTTGTACTCGAGTACAAGGTACTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-3026s1c1
Sequence:CCGGGCGTGGAAAGTGTTGACAGATCTCGAGATCTGTCAACACTTTCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-2204s1c1
Sequence:CCGGGCTCTATTACAGGACCCTGAACTCGAGTTCAGGGTCCTGTAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1394s1c1
Sequence:CCGGGCTTTGGAAGAGTACCTTGTACTCGAGTACAAGGTACTCTTCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1279s1c1
Sequence:CCGGCCATCATGTGAGCAGGAACAACTCGAGTTGTTCCTGCTCACATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1718s1c1
Sequence:CCGGGCAGGAGAGATTAAAGGGTTTCTCGAGAAACCCTTTAATCTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011864
VALIDATED
PAPSS2 MISSION shRNA Lentiviral Transduction Particles
3'-phosphoadenosine 5'-phosphosulfate synthase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-1965s21c1
Sequence:CCGGGCGTGGAAAGTGTTGACAGATCTCGAGATCTGTCAACACTTTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-218s21c1
Sequence:CCGGCCATCATGTGAGCAGGAACAACTCGAGTTGTTCCTGCTCACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-657s21c1
Sequence:CCGGGCAGGAGAGATTAAAGGGTTTCTCGAGAAACCCTTTAATCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011864.3-333s21c1
Sequence:CCGGGCTTTGGAAGAGTACCTTGTACTCGAGTACAAGGTACTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-3026s1c1
Sequence:CCGGGCGTGGAAAGTGTTGACAGATCTCGAGATCTGTCAACACTTTCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-2204s1c1
Sequence:CCGGGCTCTATTACAGGACCCTGAACTCGAGTTCAGGGTCCTGTAATAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1394s1c1
Sequence:CCGGGCTTTGGAAGAGTACCTTGTACTCGAGTACAAGGTACTCTTCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1279s1c1
Sequence:CCGGCCATCATGTGAGCAGGAACAACTCGAGTTGTTCCTGCTCACATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011864.1-1718s1c1
Sequence:CCGGGCAGGAGAGATTAAAGGGTTTCTCGAGAAACCCTTTAATCTCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004670
VALIDATED
PAPSS2 MISSION shRNA Bacterial Glycerol Stock
3'-phosphoadenosine 5'-phosphosulfate synthase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-515s21c1
Sequence:CCGGCCTTAACAGAAATCTCGGATTCTCGAGAATCCGAGATTTCTGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-1770s21c1
Sequence:CCGGGCGGGTGCCAATTTCTACATTCTCGAGAATGTAGAAATTGGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-329s21c1
Sequence:CCGGCCACCATGTGAGCAGGAATAACTCGAGTTATTCCTGCTCACATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-1920s21c1
Sequence:CCGGGCTGCCTACAACAAAGCCAAACTCGAGTTTGGCTTTGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-1768s1c1
Sequence:CCGGGCTGCCTACAACAAAGCCAAACTCGAGTTTGGCTTTGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004670.2-745s1c1
Sequence:CCGGGAGCAGAACATTGTACCCTATCTCGAGATAGGGTACAATGTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-363s1c1
Sequence:CCGGCCTTAACAGAAATCTCGGATTCTCGAGAATCCGAGATTTCTGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-177s1c1
Sequence:CCGGCCACCATGTGAGCAGGAATAACTCGAGTTATTCCTGCTCACATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-1618s1c1
Sequence:CCGGGCGGGTGCCAATTTCTACATTCTCGAGAATGTAGAAATTGGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004670
VALIDATED
PAPSS2 MISSION shRNA shRNA Plasmid DNA
3'-phosphoadenosine 5'-phosphosulfate synthase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-515s21c1
Sequence:CCGGCCTTAACAGAAATCTCGGATTCTCGAGAATCCGAGATTTCTGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-1770s21c1
Sequence:CCGGGCGGGTGCCAATTTCTACATTCTCGAGAATGTAGAAATTGGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-329s21c1
Sequence:CCGGCCACCATGTGAGCAGGAATAACTCGAGTTATTCCTGCTCACATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-1920s21c1
Sequence:CCGGGCTGCCTACAACAAAGCCAAACTCGAGTTTGGCTTTGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-1768s1c1
Sequence:CCGGGCTGCCTACAACAAAGCCAAACTCGAGTTTGGCTTTGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004670.2-745s1c1
Sequence:CCGGGAGCAGAACATTGTACCCTATCTCGAGATAGGGTACAATGTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-363s1c1
Sequence:CCGGCCTTAACAGAAATCTCGGATTCTCGAGAATCCGAGATTTCTGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-177s1c1
Sequence:CCGGCCACCATGTGAGCAGGAATAACTCGAGTTATTCCTGCTCACATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-1618s1c1
Sequence:CCGGGCGGGTGCCAATTTCTACATTCTCGAGAATGTAGAAATTGGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004670
VALIDATED
PAPSS2 MISSION shRNA Lentiviral Transduction Particles
3'-phosphoadenosine 5'-phosphosulfate synthase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-515s21c1
Sequence:CCGGCCTTAACAGAAATCTCGGATTCTCGAGAATCCGAGATTTCTGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-1770s21c1
Sequence:CCGGGCGGGTGCCAATTTCTACATTCTCGAGAATGTAGAAATTGGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-329s21c1
Sequence:CCGGCCACCATGTGAGCAGGAATAACTCGAGTTATTCCTGCTCACATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004670.3-1920s21c1
Sequence:CCGGGCTGCCTACAACAAAGCCAAACTCGAGTTTGGCTTTGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-1768s1c1
Sequence:CCGGGCTGCCTACAACAAAGCCAAACTCGAGTTTGGCTTTGTTGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004670.2-745s1c1
Sequence:CCGGGAGCAGAACATTGTACCCTATCTCGAGATAGGGTACAATGTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-363s1c1
Sequence:CCGGCCTTAACAGAAATCTCGGATTCTCGAGAATCCGAGATTTCTGTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-177s1c1
Sequence:CCGGCCACCATGTGAGCAGGAATAACTCGAGTTATTCCTGCTCACATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004670.2-1618s1c1
Sequence:CCGGGCGGGTGCCAATTTCTACATTCTCGAGAATGTAGAAATTGGCACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks