EMAIL THIS PAGE TO A FRIEND

PAQR9

progestin and adipoQ receptor family member IX

UniProtKB ID: Q6ZVX9, Q147T6
Gene ID:
Mouse(75552) progestin and adipoQ receptor family member IX
Rat(315904) progestin and adipoQ receptor family member IX
sheep(101106054) progestin and adipoQ receptor family member IX
domestic guinea pig(100713771) progestin and adipoQ receptor family member IX
cow(522374) progestin and adipoQ receptor family member IX
domestic cat(101087517) progestin and adipoQ receptor family member IX
dog(485700) progestin and adipoQ receptor family member IX
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018481 MISSION® esiRNA esiRNA targeting human PAQR9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198504 Rosetta Predictions human pricing
XM_001068629 Rosetta Predictions rat pricing
XM_236503 Rosetta Predictions rat pricing
NM_198414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146326 predicted 1554
2 SASI_Hs01_00146327 predicted 250
3 SASI_Hs01_00146328 predicted 1380
4 SASI_Hs01_00146329 predicted 238
5 SASI_Hs01_00146330 predicted 807
6 SASI_Hs01_00146331 predicted 954
7 SASI_Hs01_00146332 predicted 1402
8 SASI_Hs01_00146333 predicted 294
9 SASI_Hs01_00146334 predicted 1344
10 SASI_Hs02_00372074 predicted 1147
11 SASI_Hs01_00146335 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325216 predicted 1397
2 SASI_Rn02_00325217 predicted 1430
3 SASI_Rn02_00325218 predicted 1390
4 SASI_Rn02_00325219 predicted 1379
5 SASI_Rn02_00325220 predicted 684
6 SASI_Rn02_00325221 predicted 761
7 SASI_Rn02_00325222 predicted 598
8 SASI_Rn02_00325223 predicted 1494
9 SASI_Rn02_00325224 predicted 828
10 SASI_Rn02_00325225 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390099 predicted 1452
2 SASI_Rn02_00390100 predicted 1480
3 SASI_Rn02_00390101 predicted 1436
4 SASI_Rn02_00390102 predicted 1431
5 SASI_Rn02_00390103 predicted 734
6 SASI_Rn02_00390104 predicted 809
7 SASI_Rn02_00390105 predicted 780
8 SASI_Rn02_00390106 predicted 641
9 SASI_Rn02_00390107 predicted 1542
10 SASI_Rn02_00390108 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046527 predicted 1671
2 SASI_Mm01_00046528 predicted 1692
3 SASI_Mm01_00046529 predicted 1699
4 SASI_Mm01_00046530 predicted 374
5 SASI_Mm01_00046531 predicted 1744
6 SASI_Mm01_00046533 predicted 1744
7 SASI_Mm01_00046534 predicted 1765
8 SASI_Mm01_00046535 predicted 863
9 SASI_Mm01_00046536 predicted 1766
10 SASI_Mm02_00350964 predicted 1756
11 SASI_Mm01_00046532 predicted 1664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198504
VALIDATED
PAQR9 MISSION shRNA Bacterial Glycerol Stock
progestin and adipoQ receptor family member IX
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198504.2-294s21c1
Sequence:CCGGGAGCAAGTTCTGCCGTCTGTTCTCGAGAACAGACGGCAGAACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198504.2-1467s21c1
Sequence:CCGGCATCTGTGCCATTGGTAATAACTCGAGTTATTACCAATGGCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-1098s1c1
Sequence:CCGGGTTCCTAAACAGCTCCGAATTCTCGAGAATTCGGAGCTGTTTAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198504.1-252s1c1
Sequence:CCGGGCTCAACTTCTGGACGCACTTCTCGAGAAGTGCGTCCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-693s1c1
Sequence:CCGGCCGTACCGACTGGTGTACCTACTCGAGTAGGTACACCAGTCGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-453s1c1
Sequence:CCGGCGCCTTCTTCTACCTGGACTACTCGAGTAGTCCAGGTAGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-970s1c1
Sequence:CCGGGACCAGGTGTACTACGTAGAACTCGAGTTCTACGTAGTACACCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198504
VALIDATED
PAQR9 MISSION shRNA shRNA Plasmid DNA
progestin and adipoQ receptor family member IX
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198504.2-294s21c1
Sequence:CCGGGAGCAAGTTCTGCCGTCTGTTCTCGAGAACAGACGGCAGAACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198504.2-1467s21c1
Sequence:CCGGCATCTGTGCCATTGGTAATAACTCGAGTTATTACCAATGGCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-1098s1c1
Sequence:CCGGGTTCCTAAACAGCTCCGAATTCTCGAGAATTCGGAGCTGTTTAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198504.1-252s1c1
Sequence:CCGGGCTCAACTTCTGGACGCACTTCTCGAGAAGTGCGTCCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-693s1c1
Sequence:CCGGCCGTACCGACTGGTGTACCTACTCGAGTAGGTACACCAGTCGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-453s1c1
Sequence:CCGGCGCCTTCTTCTACCTGGACTACTCGAGTAGTCCAGGTAGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-970s1c1
Sequence:CCGGGACCAGGTGTACTACGTAGAACTCGAGTTCTACGTAGTACACCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198504
VALIDATED
PAQR9 MISSION shRNA Lentiviral Transduction Particles
progestin and adipoQ receptor family member IX
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198504.2-294s21c1
Sequence:CCGGGAGCAAGTTCTGCCGTCTGTTCTCGAGAACAGACGGCAGAACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198504.2-1467s21c1
Sequence:CCGGCATCTGTGCCATTGGTAATAACTCGAGTTATTACCAATGGCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-1098s1c1
Sequence:CCGGGTTCCTAAACAGCTCCGAATTCTCGAGAATTCGGAGCTGTTTAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198504.1-252s1c1
Sequence:CCGGGCTCAACTTCTGGACGCACTTCTCGAGAAGTGCGTCCAGAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-693s1c1
Sequence:CCGGCCGTACCGACTGGTGTACCTACTCGAGTAGGTACACCAGTCGGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-453s1c1
Sequence:CCGGCGCCTTCTTCTACCTGGACTACTCGAGTAGTCCAGGTAGAAGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_198504.1-970s1c1
Sequence:CCGGGACCAGGTGTACTACGTAGAACTCGAGTTCTACGTAGTACACCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198414
VALIDATED
PAQR9 MISSION shRNA Bacterial Glycerol Stock
progestin and adipoQ receptor family member IX
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-1679s1c1
Sequence:CCGGGCTTGGATTTGTCGAAAGAATCTCGAGATTCTTTCGACAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-607s1c1
Sequence:CCGGCTACGCTTCCATCAGCTACTACTCGAGTAGTAGCTGATGGAAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-391s1c1
Sequence:CCGGCAACTTCTGGACGCACTTCATCTCGAGATGAAGTGCGTCCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-1037s1c1
Sequence:CCGGCCGGGTCTCTTCGACATCATTCTCGAGAATGATGTCGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198414
VALIDATED
PAQR9 MISSION shRNA shRNA Plasmid DNA
progestin and adipoQ receptor family member IX
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-1679s1c1
Sequence:CCGGGCTTGGATTTGTCGAAAGAATCTCGAGATTCTTTCGACAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-607s1c1
Sequence:CCGGCTACGCTTCCATCAGCTACTACTCGAGTAGTAGCTGATGGAAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-391s1c1
Sequence:CCGGCAACTTCTGGACGCACTTCATCTCGAGATGAAGTGCGTCCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-1037s1c1
Sequence:CCGGCCGGGTCTCTTCGACATCATTCTCGAGAATGATGTCGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198414
VALIDATED
PAQR9 MISSION shRNA Lentiviral Transduction Particles
progestin and adipoQ receptor family member IX
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-1679s1c1
Sequence:CCGGGCTTGGATTTGTCGAAAGAATCTCGAGATTCTTTCGACAAATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-607s1c1
Sequence:CCGGCTACGCTTCCATCAGCTACTACTCGAGTAGTAGCTGATGGAAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-391s1c1
Sequence:CCGGCAACTTCTGGACGCACTTCATCTCGAGATGAAGTGCGTCCAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198414.1-1037s1c1
Sequence:CCGGCCGGGTCTCTTCGACATCATTCTCGAGAATGATGTCGAAGAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks