EMAIL THIS PAGE TO A FRIEND

PARD3B

par-3 family cell polarity regulator beta

Synonyms: ALS2CR19 PAR3B PAR3L PAR3LC PAR3beta Par3Lb
Gene ID:
Mouse(72823) par-3 partitioning defective 3 homolog B (C. elegans)
Rat(301455) par-3 partitioning defective 3 homolog B (C. elegans)
chicken(426120) par-3 partitioning defective 3 homolog B (C. elegans)
dog(478879) par-3 partitioning defective 3 homolog B (C. elegans)
cow(535378) par-3 partitioning defective 3 homolog B (C. elegans)
domestic cat(101089538) par-3 partitioning defective 3 homolog B (C. elegans)
Domestic Rabbit(100339145) par-3 partitioning defective 3 homolog B (C. elegans)
naked mole-rat(101721009) par-3 partitioning defective 3 homolog B (C. elegans)
domestic guinea pig(100715818) par-3 partitioning defective 3 homolog B (C. elegans)
sheep(101113827) par-3 partitioning defective 3 homolog B (C. elegans)
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_057177 Rosetta Predictions human pricing
NM_152526 Rosetta Predictions human pricing
NM_205863 Rosetta Predictions human pricing
XM_001066763 Rosetta Predictions rat pricing
XM_237215 Rosetta Predictions rat pricing
NM_001081050 Rosetta Predictions mouse pricing
XM_110852 Rosetta Predictions mouse pricing
XM_901307 Rosetta Predictions mouse pricing
XM_901310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362041 predicted 419
2 SASI_Hs01_00083821 predicted 384
3 SASI_Hs01_00083822 predicted 758
4 SASI_Hs01_00083824 predicted 1185
5 SASI_Hs01_00083826 predicted 2125
6 SASI_Hs02_00362042 predicted 2050
7 SASI_Hs02_00362043 predicted 1102
8 SASI_Hs01_00083829 predicted 331
9 SASI_Hs02_00362044 predicted 2025
10 SASI_Hs02_00362045 predicted 780
11 SASI_Hs01_00083820 predicted 852
12 SASI_Hs01_00083823 predicted 1028
13 SASI_Hs01_00083825 predicted 777
14 SASI_Hs01_00083827 predicted 1009
15 SASI_Hs01_00083828 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366321 predicted 421
2 SASI_Hs01_00123420 predicted 383
3 SASI_Hs01_00123421 predicted 755
4 SASI_Hs01_00123423 predicted 1183
5 SASI_Hs01_00123425 predicted 1936
6 SASI_Hs02_00366322 predicted 1861
7 SASI_Hs02_00366323 predicted 1096
8 SASI_Hs01_00123428 predicted 329
9 SASI_Hs02_00366324 predicted 1834
10 SASI_Hs02_00366325 predicted 779
11 SASI_Hs01_00123419 predicted 855
12 SASI_Hs01_00123422 predicted 1025
13 SASI_Hs01_00123424 predicted 783
14 SASI_Hs01_00123426 predicted 1011
15 SASI_Hs01_00123427 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373506 predicted 424
2 SASI_Hs01_00135304 predicted 382
3 SASI_Hs01_00135305 predicted 756
4 SASI_Hs01_00135307 predicted 1185
5 SASI_Hs01_00135309 predicted 2129
6 SASI_Hs02_00373507 predicted 2053
7 SASI_Hs02_00373508 predicted 1102
8 SASI_Hs01_00135312 predicted 331
9 SASI_Hs02_00373509 predicted 2022
10 SASI_Hs02_00373510 predicted 780
11 SASI_Hs01_00135303 predicted 855
12 SASI_Hs01_00135306 predicted 1019
13 SASI_Hs01_00135308 predicted 778
14 SASI_Hs01_00135310 predicted 1009
15 SASI_Hs01_00135311 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318652 predicted 1138
2 SASI_Rn02_00318653 predicted 2293
3 SASI_Rn02_00318654 predicted 799
4 SASI_Rn02_00318655 predicted 479
5 SASI_Rn02_00318656 predicted 3065
6 SASI_Rn02_00318657 predicted 2161
7 SASI_Rn02_00318658 predicted 811
8 SASI_Rn02_00318659 predicted 3328
9 SASI_Rn02_00318660 predicted 1872
10 SASI_Rn02_00318661 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390747 predicted 3380
2 SASI_Rn02_00390748 predicted 3121
3 SASI_Rn02_00390749 predicted 2288
4 SASI_Rn02_00390750 predicted 3062
5 SASI_Rn02_00390751 predicted 2159
6 SASI_Rn02_00390752 predicted 2136
7 SASI_Rn02_00390753 predicted 3124
8 SASI_Rn02_00390754 predicted 3327
9 SASI_Rn02_00390755 predicted 2039
10 SASI_Rn02_00390756 predicted 3439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294681 predicted 895
2 SASI_Mm02_00294682 predicted 3240
3 SASI_Mm02_00294683 predicted 2515
4 SASI_Mm02_00294684 predicted 649
5 SASI_Mm02_00294685 predicted 2343
6 SASI_Mm02_00294686 predicted 3504
7 SASI_Mm02_00294687 predicted 1313
8 SASI_Mm02_00294688 predicted 1767
9 SASI_Mm02_00294689 predicted 989
10 SASI_Mm02_00294690 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_110852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273507 predicted 485
2 SASI_Mm01_00273508 predicted 2644
3 SASI_Mm01_00273509 predicted 1912
4 SASI_Mm01_00273510 predicted 247
5 SASI_Mm01_00273511 predicted 1746
6 SASI_Mm01_00273512 predicted 2904
7 SASI_Mm01_00273513 predicted 897
8 SASI_Mm01_00273514 predicted 225
9 SASI_Mm01_00273515 predicted 587
10 SASI_Mm01_00273516 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230204 predicted 1863
2 SASI_Mm01_00230205 predicted 1258
3 SASI_Mm01_00230206 predicted 843
4 SASI_Mm01_00230207 predicted 599
5 SASI_Mm01_00230208 predicted 1888
6 SASI_Mm01_00230209 predicted 1708
7 SASI_Mm01_00230210 predicted 941
8 SASI_Mm01_00230211 predicted 1101
9 SASI_Mm01_00230212 predicted 1197
10 SASI_Mm01_00230213 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260741 predicted 482
2 SASI_Mm01_00260742 predicted 2105
3 SASI_Mm01_00260743 predicted 238
4 SASI_Mm01_00260744 predicted 1925
5 SASI_Mm01_00260745 predicted 2792
6 SASI_Mm01_00260746 predicted 895
7 SASI_Mm01_00260747 predicted 229
8 SASI_Mm01_00260748 predicted 587
9 SASI_Mm01_00260749 predicted 2055
10 SASI_Mm01_00260750 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057177
PARD3B MISSION shRNA Bacterial Glycerol Stock
par-3 family cell polarity regulator beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-2238s21c1
Sequence:CCGGGGTGGATTCAGCAGTATATTTCTCGAGAAATATACTGCTGAATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-1418s21c1
Sequence:CCGGTACATGGTCCCGGTCCCATTTCTCGAGAAATGGGACCGGGACCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-2056s21c1
Sequence:CCGGGTAACCACCTCTAGGCGAAATCTCGAGATTTCGCCTAGAGGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-753s21c1
Sequence:CCGGTGTACAGACAGAACTACTAACCTCGAGGTTAGTAGTTCTGTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057177.4-2734s1c1
Sequence:CCGGGCGTGAAAGGATTGGAGCAAACTCGAGTTTGCTCCAATCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-779s1c1
Sequence:CCGGCGCCAAGAACTAAGGACACATCTCGAGATGTGTCCTTAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-2032s1c1
Sequence:CCGGCCATGCTTTGAGAACTGTCAACTCGAGTTGACAGTTCTCAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-1895s1c1
Sequence:CCGGCCAACCACGAAGCTATGGAAACTCGAGTTTCCATAGCTTCGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-331s1c1
Sequence:CCGGCCTGGTTACTGGGTGAAGATTCTCGAGAATCTTCACCCAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057177
PARD3B MISSION shRNA shRNA Plasmid DNA
par-3 family cell polarity regulator beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-2238s21c1
Sequence:CCGGGGTGGATTCAGCAGTATATTTCTCGAGAAATATACTGCTGAATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-1418s21c1
Sequence:CCGGTACATGGTCCCGGTCCCATTTCTCGAGAAATGGGACCGGGACCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-2056s21c1
Sequence:CCGGGTAACCACCTCTAGGCGAAATCTCGAGATTTCGCCTAGAGGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-753s21c1
Sequence:CCGGTGTACAGACAGAACTACTAACCTCGAGGTTAGTAGTTCTGTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057177.4-2734s1c1
Sequence:CCGGGCGTGAAAGGATTGGAGCAAACTCGAGTTTGCTCCAATCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-779s1c1
Sequence:CCGGCGCCAAGAACTAAGGACACATCTCGAGATGTGTCCTTAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-2032s1c1
Sequence:CCGGCCATGCTTTGAGAACTGTCAACTCGAGTTGACAGTTCTCAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-1895s1c1
Sequence:CCGGCCAACCACGAAGCTATGGAAACTCGAGTTTCCATAGCTTCGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-331s1c1
Sequence:CCGGCCTGGTTACTGGGTGAAGATTCTCGAGAATCTTCACCCAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057177
PARD3B MISSION shRNA Lentiviral Transduction Particles
par-3 family cell polarity regulator beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-2238s21c1
Sequence:CCGGGGTGGATTCAGCAGTATATTTCTCGAGAAATATACTGCTGAATCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-1418s21c1
Sequence:CCGGTACATGGTCCCGGTCCCATTTCTCGAGAAATGGGACCGGGACCATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-2056s21c1
Sequence:CCGGGTAACCACCTCTAGGCGAAATCTCGAGATTTCGCCTAGAGGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057177.5-753s21c1
Sequence:CCGGTGTACAGACAGAACTACTAACCTCGAGGTTAGTAGTTCTGTCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057177.4-2734s1c1
Sequence:CCGGGCGTGAAAGGATTGGAGCAAACTCGAGTTTGCTCCAATCCTTTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-779s1c1
Sequence:CCGGCGCCAAGAACTAAGGACACATCTCGAGATGTGTCCTTAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-2032s1c1
Sequence:CCGGCCATGCTTTGAGAACTGTCAACTCGAGTTGACAGTTCTCAAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-1895s1c1
Sequence:CCGGCCAACCACGAAGCTATGGAAACTCGAGTTTCCATAGCTTCGTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057177.4-331s1c1
Sequence:CCGGCCTGGTTACTGGGTGAAGATTCTCGAGAATCTTCACCCAGTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081050
PARD3B MISSION shRNA Bacterial Glycerol Stock
par-3 family cell polarity regulator beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2517s21c1
Sequence:CCGGCCCGAATTGATTAACCTTAAACTCGAGTTTAAGGTTAATCAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2761s21c1
Sequence:CCGGTCCGAGCAGCCATCGACAAATCTCGAGATTTGTCGATGGCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081050.2-5717s21c1
Sequence:CCGGTCGACGTAAATAGCGTCATTTCTCGAGAAATGACGCTATTTACGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2282s21c1
Sequence:CCGGGCGAAATGATAGTAGTATATTCTCGAGAATATACTACTATCATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-1318s21c1
Sequence:CCGGTCATTGGACCACTCAACATTTCTCGAGAAATGTTGAGTGGTCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081050
PARD3B MISSION shRNA shRNA Plasmid DNA
par-3 family cell polarity regulator beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2517s21c1
Sequence:CCGGCCCGAATTGATTAACCTTAAACTCGAGTTTAAGGTTAATCAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2761s21c1
Sequence:CCGGTCCGAGCAGCCATCGACAAATCTCGAGATTTGTCGATGGCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081050.2-5717s21c1
Sequence:CCGGTCGACGTAAATAGCGTCATTTCTCGAGAAATGACGCTATTTACGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2282s21c1
Sequence:CCGGGCGAAATGATAGTAGTATATTCTCGAGAATATACTACTATCATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-1318s21c1
Sequence:CCGGTCATTGGACCACTCAACATTTCTCGAGAAATGTTGAGTGGTCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081050
PARD3B MISSION shRNA Lentiviral Transduction Particles
par-3 family cell polarity regulator beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2517s21c1
Sequence:CCGGCCCGAATTGATTAACCTTAAACTCGAGTTTAAGGTTAATCAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2761s21c1
Sequence:CCGGTCCGAGCAGCCATCGACAAATCTCGAGATTTGTCGATGGCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081050.2-5717s21c1
Sequence:CCGGTCGACGTAAATAGCGTCATTTCTCGAGAAATGACGCTATTTACGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-2282s21c1
Sequence:CCGGGCGAAATGATAGTAGTATATTCTCGAGAATATACTACTATCATTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081050.2-1318s21c1
Sequence:CCGGTCATTGGACCACTCAACATTTCTCGAGAAATGTTGAGTGGTCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks