EMAIL THIS PAGE TO A FRIEND

PARD6B

par-6 family cell polarity regulator beta

Synonyms: PAR6B
UniProtKB ID: Q9BYG5, Q9Y510
Gene ID:
Human(84612) Summary: This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain, an OPR domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cytoplasmic protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. [provided by RefSeq, Jul 2008]
Mouse(58220) par-6 (partitioning defective 6) homolog beta (C. elegans)
Rat(362279) par-6 (partitioning defective 6) homolog beta (C. elegans)
Zebrafish(100124652) par-6 partitioning defective 6 homolog beta (C. elegans)
dog(485926) par-6 partitioning defective 6 homolog beta (C. elegans)
cow(539687) par-6 partitioning defective 6 homolog beta (C. elegans)
Horse(100052187) par-6 partitioning defective 6 homolog beta (C. elegans)
domestic cat(101081032) par-6 partitioning defective 6 homolog beta (C. elegans)
chicken(419352) par-6 partitioning defective 6 homolog beta (C. elegans)
naked mole-rat(101724837) par-6 partitioning defective 6 homolog beta (C. elegans)
sheep(101118720) par-6 partitioning defective 6 homolog beta (C. elegans)
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032521 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032521 Rosetta Predictions human pricing
NM_001108609 Rosetta Predictions rat pricing
NM_021409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360013 predicted 1279
2 SASI_Hs01_00154461 predicted 649
3 SASI_Hs02_00360014 predicted 561
4 SASI_Hs02_00360015 predicted 564
5 SASI_Hs01_00154462 predicted 698
6 SASI_Hs01_00154463 predicted 308
7 SASI_Hs01_00154464 predicted 952
8 SASI_Hs01_00154465 predicted 551
9 SASI_Hs01_00154466 predicted 1210
10 SASI_Hs01_00154467 predicted 895
11 SASI_Hs01_00154468 predicted 1203
12 SASI_Hs01_00154469 predicted 853
13 SASI_Hs01_00154470 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240319 predicted 1359
2 SASI_Rn02_00240320 predicted 765
3 SASI_Rn02_00240321 predicted 870
4 SASI_Rn02_00240322 predicted 1320
5 SASI_Rn02_00240323 predicted 401
6 SASI_Rn02_00240324 predicted 893
7 SASI_Rn02_00240325 predicted 1318
8 SASI_Rn02_00240326 predicted 1390
9 SASI_Rn02_00240327 predicted 494
10 SASI_Rn02_00240328 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026525 predicted 496
2 SASI_Mm01_00026526 predicted 648
3 SASI_Mm01_00026528 predicted 259
4 SASI_Mm01_00026529 predicted 626
5 SASI_Mm01_00026530 predicted 209
6 SASI_Mm01_00026531 predicted 659
7 SASI_Mm02_00326044 predicted 244
8 SASI_Mm01_00026532 predicted 292
9 SASI_Mm01_00026533 predicted 538
10 SASI_Mm01_00026534 predicted 414
11 SASI_Mm01_00026527 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021409
VALIDATED
PARD6B MISSION shRNA Bacterial Glycerol Stock
par-6 family cell polarity regulator beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021409.2-1897s21c1
Sequence:CCGGCCAGTCCAGTGGAGATTATTTCTCGAGAAATAATCTCCACTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-465s21c1
Sequence:CCGGTTGGTGGGCTACGCAGATATCCTCGAGGATATCTGCGTAGCCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-933s21c1
Sequence:CCGGGTGTTAGAAGTCAACGGTATACTCGAGTATACCGTTGACTTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-1357s21c1
Sequence:CCGGCTCCGGACCAGAAACTCTTAGCTCGAGCTAAGAGTTTCTGGTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-1383s21c1
Sequence:CCGGGATGGGACAATCATAACATTGCTCGAGCAATGTTATGATTGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-637s1c1
Sequence:CCGGGCTGTCAACGATGAGGTGTTACTCGAGTAACACCTCATCGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-652s1c1
Sequence:CCGGGTGTTAGAAGTCAACGGTATACTCGAGTATACCGTTGACTTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-263s1c1
Sequence:CCGGCCAATCCACTGCTCAGGATTTCTCGAGAAATCCTGAGCAGTGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-301s1c1
Sequence:CCGGGAAGCTGACTACAGTGCCTTTCTCGAGAAAGGCACTGTAGTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021409.1-216s1c1
Sequence:CCGGGCCGCCTATAAATAATGATGACTCGAGTCATCATTATTTATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021409
VALIDATED
PARD6B MISSION shRNA shRNA Plasmid DNA
par-6 family cell polarity regulator beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021409.2-1897s21c1
Sequence:CCGGCCAGTCCAGTGGAGATTATTTCTCGAGAAATAATCTCCACTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-465s21c1
Sequence:CCGGTTGGTGGGCTACGCAGATATCCTCGAGGATATCTGCGTAGCCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-933s21c1
Sequence:CCGGGTGTTAGAAGTCAACGGTATACTCGAGTATACCGTTGACTTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-1357s21c1
Sequence:CCGGCTCCGGACCAGAAACTCTTAGCTCGAGCTAAGAGTTTCTGGTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-1383s21c1
Sequence:CCGGGATGGGACAATCATAACATTGCTCGAGCAATGTTATGATTGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-637s1c1
Sequence:CCGGGCTGTCAACGATGAGGTGTTACTCGAGTAACACCTCATCGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-652s1c1
Sequence:CCGGGTGTTAGAAGTCAACGGTATACTCGAGTATACCGTTGACTTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-263s1c1
Sequence:CCGGCCAATCCACTGCTCAGGATTTCTCGAGAAATCCTGAGCAGTGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-301s1c1
Sequence:CCGGGAAGCTGACTACAGTGCCTTTCTCGAGAAAGGCACTGTAGTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021409.1-216s1c1
Sequence:CCGGGCCGCCTATAAATAATGATGACTCGAGTCATCATTATTTATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021409
VALIDATED
PARD6B MISSION shRNA Lentiviral Transduction Particles
par-6 family cell polarity regulator beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021409.2-1897s21c1
Sequence:CCGGCCAGTCCAGTGGAGATTATTTCTCGAGAAATAATCTCCACTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-465s21c1
Sequence:CCGGTTGGTGGGCTACGCAGATATCCTCGAGGATATCTGCGTAGCCCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-933s21c1
Sequence:CCGGGTGTTAGAAGTCAACGGTATACTCGAGTATACCGTTGACTTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-1357s21c1
Sequence:CCGGCTCCGGACCAGAAACTCTTAGCTCGAGCTAAGAGTTTCTGGTCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021409.2-1383s21c1
Sequence:CCGGGATGGGACAATCATAACATTGCTCGAGCAATGTTATGATTGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-637s1c1
Sequence:CCGGGCTGTCAACGATGAGGTGTTACTCGAGTAACACCTCATCGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-652s1c1
Sequence:CCGGGTGTTAGAAGTCAACGGTATACTCGAGTATACCGTTGACTTCTAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-263s1c1
Sequence:CCGGCCAATCCACTGCTCAGGATTTCTCGAGAAATCCTGAGCAGTGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021409.1-301s1c1
Sequence:CCGGGAAGCTGACTACAGTGCCTTTCTCGAGAAAGGCACTGTAGTCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021409.1-216s1c1
Sequence:CCGGGCCGCCTATAAATAATGATGACTCGAGTCATCATTATTTATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032521
VALIDATED
PARD6B MISSION shRNA Bacterial Glycerol Stock
par-6 family cell polarity regulator beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032521.1-1280s1c1
Sequence:CCGGCAAGCAGCTCAAACACGGAATCTCGAGATTCCGTGTTTGAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-924s1c1
Sequence:CCGGCCTTGATCAAGTAACAGACATCTCGAGATGTCTGTTACTTGATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-850s1c1
Sequence:CCGGGCTCAAAGTACAGGACTATTACTCGAGTAATAGTCCTGTACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-1236s1c1
Sequence:CCGGGAATGGCTTTATTCCCTCTAACTCGAGTTAGAGGGAATAAAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032521.1-2252s1c1
Sequence:CCGGCCCAGTCTCATTTGAAATCATCTCGAGATGATTTCAAATGAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032521.1-1577s1c1
Sequence:CCGGGCTGATGAAGTTACGTGCTTTCTCGAGAAAGCACGTAACTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-1075s1c1
Sequence:CCGGCAGCAGATTGAACCAAGCTTTCTCGAGAAAGCTTGGTTCAATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-709s1c1
Sequence:CCGGCGTAGGGTACGTCTTTACAAACTCGAGTTTGTAAAGACGTACCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032521.1-480s1c1
Sequence:CCGGCAAAGCTGTTTCAACGGCCAACTCGAGTTGGCCGTTGAAACAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032521.1-972s1c1
Sequence:CCGGCATAACAGTGAGACCGGCAAACTCGAGTTTGCCGGTCTCACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-603s1c1
Sequence:CCGGGCGTCCTGACAACCATAGAAACTCGAGTTTCTATGGTTGTCAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032521
VALIDATED
PARD6B MISSION shRNA shRNA Plasmid DNA
par-6 family cell polarity regulator beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032521.1-1280s1c1
Sequence:CCGGCAAGCAGCTCAAACACGGAATCTCGAGATTCCGTGTTTGAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-924s1c1
Sequence:CCGGCCTTGATCAAGTAACAGACATCTCGAGATGTCTGTTACTTGATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-850s1c1
Sequence:CCGGGCTCAAAGTACAGGACTATTACTCGAGTAATAGTCCTGTACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-1236s1c1
Sequence:CCGGGAATGGCTTTATTCCCTCTAACTCGAGTTAGAGGGAATAAAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032521.1-2252s1c1
Sequence:CCGGCCCAGTCTCATTTGAAATCATCTCGAGATGATTTCAAATGAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032521.1-1577s1c1
Sequence:CCGGGCTGATGAAGTTACGTGCTTTCTCGAGAAAGCACGTAACTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-1075s1c1
Sequence:CCGGCAGCAGATTGAACCAAGCTTTCTCGAGAAAGCTTGGTTCAATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-709s1c1
Sequence:CCGGCGTAGGGTACGTCTTTACAAACTCGAGTTTGTAAAGACGTACCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032521.1-480s1c1
Sequence:CCGGCAAAGCTGTTTCAACGGCCAACTCGAGTTGGCCGTTGAAACAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032521.1-972s1c1
Sequence:CCGGCATAACAGTGAGACCGGCAAACTCGAGTTTGCCGGTCTCACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-603s1c1
Sequence:CCGGGCGTCCTGACAACCATAGAAACTCGAGTTTCTATGGTTGTCAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032521
VALIDATED
PARD6B MISSION shRNA Lentiviral Transduction Particles
par-6 family cell polarity regulator beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_032521.1-1280s1c1
Sequence:CCGGCAAGCAGCTCAAACACGGAATCTCGAGATTCCGTGTTTGAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-924s1c1
Sequence:CCGGCCTTGATCAAGTAACAGACATCTCGAGATGTCTGTTACTTGATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-850s1c1
Sequence:CCGGGCTCAAAGTACAGGACTATTACTCGAGTAATAGTCCTGTACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-1236s1c1
Sequence:CCGGGAATGGCTTTATTCCCTCTAACTCGAGTTAGAGGGAATAAAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032521.1-2252s1c1
Sequence:CCGGCCCAGTCTCATTTGAAATCATCTCGAGATGATTTCAAATGAGACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032521.1-1577s1c1
Sequence:CCGGGCTGATGAAGTTACGTGCTTTCTCGAGAAAGCACGTAACTTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-1075s1c1
Sequence:CCGGCAGCAGATTGAACCAAGCTTTCTCGAGAAAGCTTGGTTCAATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032521.1-709s1c1
Sequence:CCGGCGTAGGGTACGTCTTTACAAACTCGAGTTTGTAAAGACGTACCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032521.1-480s1c1
Sequence:CCGGCAAAGCTGTTTCAACGGCCAACTCGAGTTGGCCGTTGAAACAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032521.1-972s1c1
Sequence:CCGGCATAACAGTGAGACCGGCAAACTCGAGTTTGCCGGTCTCACTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032521.1-603s1c1
Sequence:CCGGGCGTCCTGACAACCATAGAAACTCGAGTTTCTATGGTTGTCAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks