EMAIL THIS PAGE TO A FRIEND

PARP2

poly (ADP-ribose) polymerase 2

Synonyms: ADPRT2 ADPRTL2 ADPRTL3 ARTD2 PARP-2 pADPRT-2
UniProtKB ID: Q9UGN5, Q8TEU4, Q9NUV2, Q9UMR4, Q9Y6C8
Gene ID:
Human(10038) Summary: This gene encodes poly(ADP-ribosyl)transferase-like 2 protein, which contains a catalytic domain and is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. The basic residues within the N-terminal region of this protein may bear potential DNA-binding properties, and may be involved in the nuclear and/or nucleolar targeting of the protein. Two alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jul 2008]
Mouse(11546) poly (ADP-ribose) polymerase family, member 2
Rat(290027) poly (ADP-ribose) polymerase 2
Zebrafish(100007906) poly (ADP-ribose) polymerase family, member 2
cow(505828) poly (ADP-ribose) polymerase 2
Horse(100072572) poly (ADP-ribose) polymerase 2
domestic cat(101090944) poly (ADP-ribose) polymerase 2
dog(475392) poly (ADP-ribose) polymerase 2
domestic guinea pig(100720452) poly (ADP-ribose) polymerase 2
sheep(101118027) poly (ADP-ribose) polymerase 2
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
H57807 4-Hydroxyquinazoline 98% mouse pricing
N7287 NU-1025 ≥97% (HPLC), solid mouse pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1066 MCF10A CELLS PARP2 (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005484 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042618 Rosetta Predictions human pricing
NM_005484 Rosetta Predictions human pricing
NM_001106030 Rosetta Predictions rat pricing
NM_009632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310813 predicted 542
2 SASI_Hs02_00310814 predicted 518
3 SASI_Hs02_00310815 predicted 992
4 SASI_Hs02_00310816 predicted 817
5 SASI_Hs02_00310817 predicted 1400
6 SASI_Hs02_00310818 predicted 1344
7 SASI_Hs02_00310819 predicted 1435
8 SASI_Hs02_00310820 predicted 1394
9 SASI_Hs02_00310821 predicted 1601
10 SASI_Hs02_00310822 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131487 predicted 585
2 SASI_Hs02_00339673 predicted 558
3 SASI_Hs01_00131488 predicted 1036
4 SASI_Hs01_00131489 predicted 854
5 SASI_Hs02_00339674 predicted 1446
6 SASI_Hs01_00131493 predicted 1377
7 SASI_Hs01_00131494 predicted 1474
8 SASI_Hs02_00339675 predicted 1439
9 SASI_Hs01_00131495 predicted 1648
10 SASI_Hs01_00131496 predicted 954
11 SASI_Hs01_00131490 predicted 848
12 SASI_Hs01_00131491 predicted 394
13 SASI_Hs01_00131492 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214932 predicted 921
2 SASI_Rn02_00214933 predicted 796
3 SASI_Rn02_00214934 predicted 1363
4 SASI_Rn02_00214935 predicted 1132
5 SASI_Rn02_00214936 predicted 1370
6 SASI_Rn02_00214937 predicted 357
7 SASI_Rn02_00214938 predicted 208
8 SASI_Rn02_00214939 predicted 306
9 SASI_Rn02_00214940 predicted 216
10 SASI_Rn02_00214941 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151039 predicted 332
2 SASI_Mm01_00151040 predicted 1343
3 SASI_Mm01_00151041 predicted 761
4 SASI_Mm01_00151042 predicted 896
5 SASI_Mm01_00151043 predicted 954
6 SASI_Mm01_00151044 predicted 1337
7 SASI_Mm01_00151045 predicted 904
8 SASI_Mm01_00151047 predicted 762
9 SASI_Mm01_00151048 predicted 1104
10 SASI_Mm02_00316594 predicted 1306
11 SASI_Mm01_00151046 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009632
VALIDATED
PARP2 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-761s21c1
Sequence:CCGGCGGTTACCAGTCTCTCAAGAACTCGAGTTCTTGAGAGACTGGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009632.2-1684s21c1
Sequence:CCGGTGTTGATCAGACAAGCCAGAGCTCGAGCTCTGGCTTGTCTGATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-1631s21c1
Sequence:CCGGCCGTATGCGATACCTTCTAAACTCGAGTTTAGAAGGTATCGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-38s21c1
Sequence:CCGGGCGAGTGCTAAATGAAGCCAACTCGAGTTGGCTTCATTTAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-1101s21c1
Sequence:CCGGGCTCCTACACACAAGGACTATCTCGAGATAGTCCTTGTGTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009632.2-1684s1c1
Sequence:CCGGTGTTGATCAGACAAGCCAGAGCTCGAGCTCTGGCTTGTCTGATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-38s1c1
Sequence:CCGGGCGAGTGCTAAATGAAGCCAACTCGAGTTGGCTTCATTTAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-1631s1c1
Sequence:CCGGCCGTATGCGATACCTTCTAAACTCGAGTTTAGAAGGTATCGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-761s1c1
Sequence:CCGGCGGTTACCAGTCTCTCAAGAACTCGAGTTCTTGAGAGACTGGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-1101s1c1
Sequence:CCGGGCTCCTACACACAAGGACTATCTCGAGATAGTCCTTGTGTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009632
VALIDATED
PARP2 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-761s21c1
Sequence:CCGGCGGTTACCAGTCTCTCAAGAACTCGAGTTCTTGAGAGACTGGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009632.2-1684s21c1
Sequence:CCGGTGTTGATCAGACAAGCCAGAGCTCGAGCTCTGGCTTGTCTGATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-1631s21c1
Sequence:CCGGCCGTATGCGATACCTTCTAAACTCGAGTTTAGAAGGTATCGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-38s21c1
Sequence:CCGGGCGAGTGCTAAATGAAGCCAACTCGAGTTGGCTTCATTTAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-1101s21c1
Sequence:CCGGGCTCCTACACACAAGGACTATCTCGAGATAGTCCTTGTGTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009632.2-1684s1c1
Sequence:CCGGTGTTGATCAGACAAGCCAGAGCTCGAGCTCTGGCTTGTCTGATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-38s1c1
Sequence:CCGGGCGAGTGCTAAATGAAGCCAACTCGAGTTGGCTTCATTTAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-1631s1c1
Sequence:CCGGCCGTATGCGATACCTTCTAAACTCGAGTTTAGAAGGTATCGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-761s1c1
Sequence:CCGGCGGTTACCAGTCTCTCAAGAACTCGAGTTCTTGAGAGACTGGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-1101s1c1
Sequence:CCGGGCTCCTACACACAAGGACTATCTCGAGATAGTCCTTGTGTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009632
VALIDATED
PARP2 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-761s21c1
Sequence:CCGGCGGTTACCAGTCTCTCAAGAACTCGAGTTCTTGAGAGACTGGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009632.2-1684s21c1
Sequence:CCGGTGTTGATCAGACAAGCCAGAGCTCGAGCTCTGGCTTGTCTGATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-1631s21c1
Sequence:CCGGCCGTATGCGATACCTTCTAAACTCGAGTTTAGAAGGTATCGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-38s21c1
Sequence:CCGGGCGAGTGCTAAATGAAGCCAACTCGAGTTGGCTTCATTTAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009632.2-1101s21c1
Sequence:CCGGGCTCCTACACACAAGGACTATCTCGAGATAGTCCTTGTGTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009632.2-1684s1c1
Sequence:CCGGTGTTGATCAGACAAGCCAGAGCTCGAGCTCTGGCTTGTCTGATCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-38s1c1
Sequence:CCGGGCGAGTGCTAAATGAAGCCAACTCGAGTTGGCTTCATTTAGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-1631s1c1
Sequence:CCGGCCGTATGCGATACCTTCTAAACTCGAGTTTAGAAGGTATCGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-761s1c1
Sequence:CCGGCGGTTACCAGTCTCTCAAGAACTCGAGTTCTTGAGAGACTGGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009632.2-1101s1c1
Sequence:CCGGGCTCCTACACACAAGGACTATCTCGAGATAGTCCTTGTGTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005484
VALIDATED
PARP2 MISSION shRNA Bacterial Glycerol Stock
poly (ADP-ribose) polymerase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-1108s21c1
Sequence:CCGGACACTATAGAAACCTACATTGCTCGAGCAATGTAGGTTTCTATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-420s21c1
Sequence:CCGGACTATCTGATTCAGCTATTAGCTCGAGCTAATAGCTGAATCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-971s21c1
Sequence:CCGGCTCCGTACTCCTCCACTAATCCTCGAGGATTAGTGGAGGAGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-734s21c1
Sequence:CCGGCTTCGGGTACAGGAGTTAATACTCGAGTATTAACTCCTGTACCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-1666s21c1
Sequence:CCGGTCTGAATCCAGATGGTTATACCTCGAGGTATAACCATCTGGATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-627s1c1
Sequence:CCGGGCCACCAATACTCAGGATGAACTCGAGTTCATCCTGAGTATTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-255s1c1
Sequence:CCGGGCCTTGCTGTTAAAGGGCAAACTCGAGTTTGCCCTTTAACAGCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1295s1c1
Sequence:CCGGGATGAGTAACTGGGTGGGAATCTCGAGATTCCCACCCAGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1516s1c1
Sequence:CCGGCCGAAGGATTGCTTCAAGGTACTCGAGTACCTTGAAGCAATCCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1121s1c1
Sequence:CCGGCCATGAAAGTTACGAGTTCAACTCGAGTTGAACTCGTAACTTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005484
VALIDATED
PARP2 MISSION shRNA shRNA Plasmid DNA
poly (ADP-ribose) polymerase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-1108s21c1
Sequence:CCGGACACTATAGAAACCTACATTGCTCGAGCAATGTAGGTTTCTATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-420s21c1
Sequence:CCGGACTATCTGATTCAGCTATTAGCTCGAGCTAATAGCTGAATCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-971s21c1
Sequence:CCGGCTCCGTACTCCTCCACTAATCCTCGAGGATTAGTGGAGGAGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-734s21c1
Sequence:CCGGCTTCGGGTACAGGAGTTAATACTCGAGTATTAACTCCTGTACCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-1666s21c1
Sequence:CCGGTCTGAATCCAGATGGTTATACCTCGAGGTATAACCATCTGGATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-627s1c1
Sequence:CCGGGCCACCAATACTCAGGATGAACTCGAGTTCATCCTGAGTATTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-255s1c1
Sequence:CCGGGCCTTGCTGTTAAAGGGCAAACTCGAGTTTGCCCTTTAACAGCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1295s1c1
Sequence:CCGGGATGAGTAACTGGGTGGGAATCTCGAGATTCCCACCCAGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1516s1c1
Sequence:CCGGCCGAAGGATTGCTTCAAGGTACTCGAGTACCTTGAAGCAATCCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1121s1c1
Sequence:CCGGCCATGAAAGTTACGAGTTCAACTCGAGTTGAACTCGTAACTTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005484
VALIDATED
PARP2 MISSION shRNA Lentiviral Transduction Particles
poly (ADP-ribose) polymerase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-1108s21c1
Sequence:CCGGACACTATAGAAACCTACATTGCTCGAGCAATGTAGGTTTCTATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-420s21c1
Sequence:CCGGACTATCTGATTCAGCTATTAGCTCGAGCTAATAGCTGAATCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-971s21c1
Sequence:CCGGCTCCGTACTCCTCCACTAATCCTCGAGGATTAGTGGAGGAGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-734s21c1
Sequence:CCGGCTTCGGGTACAGGAGTTAATACTCGAGTATTAACTCCTGTACCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005484.3-1666s21c1
Sequence:CCGGTCTGAATCCAGATGGTTATACCTCGAGGTATAACCATCTGGATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-627s1c1
Sequence:CCGGGCCACCAATACTCAGGATGAACTCGAGTTCATCCTGAGTATTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-255s1c1
Sequence:CCGGGCCTTGCTGTTAAAGGGCAAACTCGAGTTTGCCCTTTAACAGCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1295s1c1
Sequence:CCGGGATGAGTAACTGGGTGGGAATCTCGAGATTCCCACCCAGTTACTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1516s1c1
Sequence:CCGGCCGAAGGATTGCTTCAAGGTACTCGAGTACCTTGAAGCAATCCTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005484.2-1121s1c1
Sequence:CCGGCCATGAAAGTTACGAGTTCAACTCGAGTTGAACTCGTAACTTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks