EMAIL THIS PAGE TO A FRIEND

PARS2

prolyl-tRNA synthetase 2, mitochondrial (putative)

Synonyms: MT-PRORS
UniProtKB ID: Q7L3T8, A8K0W4, Q9H6S5, Q9UFT1
Gene ID:
Mouse(230577) prolyl-tRNA synthetase (mitochondrial)(putative)
Rat(313429) prolyl-tRNA synthetase 2, mitochondrial (putative)
Zebrafish(325494) prolyl-tRNA synthetase (mitochondrial)
chicken(424659) prolyl-tRNA synthetase 2, mitochondrial (putative)
domestic cat(101098477) prolyl-tRNA synthetase 2, mitochondrial (putative)
cow(508907) prolyl-tRNA synthetase 2, mitochondrial (putative)
Horse(100060353) prolyl-tRNA synthetase 2, mitochondrial (putative)
dog(489574) prolyl-tRNA synthetase 2, mitochondrial (putative)
sheep(101122641) prolyl-tRNA synthetase 2, mitochondrial (putative)
domestic guinea pig(100732913) prolyl-tRNA synthetase 2, mitochondrial (putative)
naked mole-rat(101704684) prolyl-tRNA synthetase 2, mitochondrial (putative)
Domestic Rabbit(100339914) prolyl-tRNA synthetase 2, mitochondrial (putative)
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152268 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152268 Rosetta Predictions human pricing
NM_001014064 Rosetta Predictions rat pricing
NM_001083887 Rosetta Predictions mouse pricing
NM_172272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365780 predicted 926
2 SASI_Hs02_00365781 predicted 491
3 SASI_Hs02_00365782 predicted 261
4 SASI_Hs01_00042239 predicted 1058
5 SASI_Hs01_00042240 predicted 1458
6 SASI_Hs02_00365783 predicted 529
7 SASI_Hs02_00365784 predicted 336
8 SASI_Hs02_00365785 predicted 1321
9 SASI_Hs02_00365786 predicted 914
10 SASI_Hs02_00365787 predicted 1016
11 SASI_Hs01_00042232 predicted 959
12 SASI_Hs01_00042233 predicted 590
13 SASI_Hs01_00042234 predicted 743
14 SASI_Hs01_00042235 predicted 1342
15 SASI_Hs01_00042236 predicted 1491
16 SASI_Hs01_00042237 predicted 1074
17 SASI_Hs01_00042238 predicted 1021
18 SASI_Hs01_00042241 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054501 predicted 1142
2 SASI_Rn01_00054502 predicted 733
3 SASI_Rn01_00054503 predicted 397
4 SASI_Rn01_00054504 predicted 876
5 SASI_Rn01_00054505 predicted 650
6 SASI_Rn01_00054506 predicted 1371
7 SASI_Rn02_00201461 predicted 1059
8 SASI_Rn01_00054507 predicted 752
9 SASI_Rn01_00054508 predicted 1668
10 SASI_Rn01_00054509 predicted 1319
11 SASI_Rn01_00054510 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299841 predicted 1849
2 SASI_Mm02_00299842 predicted 2407
3 SASI_Mm02_00299843 predicted 1683
4 SASI_Mm02_00299844 predicted 1179
5 SASI_Mm02_00299845 predicted 1976
6 SASI_Mm02_00299846 predicted 1639
7 SASI_Mm02_00299847 predicted 1813
8 SASI_Mm02_00299848 predicted 2169
9 SASI_Mm02_00299849 predicted 1597
10 SASI_Mm02_00299850 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343751 predicted 996
2 SASI_Mm01_00055464 predicted 1558
3 SASI_Mm01_00055465 predicted 836
4 SASI_Mm01_00055466 predicted 331
5 SASI_Mm01_00055467 predicted 1129
6 SASI_Mm02_00343752 predicted 797
7 SASI_Mm02_00343753 predicted 965
8 SASI_Mm01_00055469 predicted 1321
9 SASI_Mm02_00343754 predicted 749
10 SASI_Mm01_00055470 predicted 364
11 SASI_Mm01_00055463 predicted 970
12 SASI_Mm01_00055468 predicted 732
13 SASI_Mm01_00055471 predicted 505
14 SASI_Mm01_00055472 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172272
PARS2 MISSION shRNA Bacterial Glycerol Stock
prolyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172272.1-1666s1c1
Sequence:CCGGGCTACCATACACCGTTCCTTTCTCGAGAAAGGAACGGTGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-1382s1c1
Sequence:CCGGGCACACTTTGAGGTTTGGTCTCTCGAGAGACCAAACCTCAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-581s1c1
Sequence:CCGGCCCTTGTTGTTGTACCAGGTTCTCGAGAACCTGGTACAACAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-553s1c1
Sequence:CCGGCCAGAAGAAACTTTCCTACAACTCGAGTTGTAGGAAAGTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-166s1c1
Sequence:CCGGCTTGGTATTATCCCGCATGTTCTCGAGAACATGCGGGATAATACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172272
PARS2 MISSION shRNA shRNA Plasmid DNA
prolyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172272.1-1666s1c1
Sequence:CCGGGCTACCATACACCGTTCCTTTCTCGAGAAAGGAACGGTGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-1382s1c1
Sequence:CCGGGCACACTTTGAGGTTTGGTCTCTCGAGAGACCAAACCTCAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-581s1c1
Sequence:CCGGCCCTTGTTGTTGTACCAGGTTCTCGAGAACCTGGTACAACAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-553s1c1
Sequence:CCGGCCAGAAGAAACTTTCCTACAACTCGAGTTGTAGGAAAGTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-166s1c1
Sequence:CCGGCTTGGTATTATCCCGCATGTTCTCGAGAACATGCGGGATAATACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172272
PARS2 MISSION shRNA Lentiviral Transduction Particles
prolyl-tRNA synthetase 2, mitochondrial (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172272.1-1666s1c1
Sequence:CCGGGCTACCATACACCGTTCCTTTCTCGAGAAAGGAACGGTGTATGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-1382s1c1
Sequence:CCGGGCACACTTTGAGGTTTGGTCTCTCGAGAGACCAAACCTCAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-581s1c1
Sequence:CCGGCCCTTGTTGTTGTACCAGGTTCTCGAGAACCTGGTACAACAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-553s1c1
Sequence:CCGGCCAGAAGAAACTTTCCTACAACTCGAGTTGTAGGAAAGTTTCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172272.1-166s1c1
Sequence:CCGGCTTGGTATTATCCCGCATGTTCTCGAGAACATGCGGGATAATACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152268
PARS2 MISSION shRNA Bacterial Glycerol Stock
prolyl-tRNA synthetase 2, mitochondrial (putative)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-1465s1c1
Sequence:CCGGCCAAAGATGGAGTCATGGATTCTCGAGAATCCATGACTCCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-930s1c1
Sequence:CCGGGAGACACTAGACTTGTCACAACTCGAGTTGTGACAAGTCTAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-1060s1c1
Sequence:CCGGCCAATGTCTGTGGCAAACCAACTCGAGTTGGTTTGCCACAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-480s1c1
Sequence:CCGGCGGTGGGACTTGATGGGCAAACTCGAGTTTGCCCATCAAGTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-561s1c1
Sequence:CCGGGAAGCCATTACGGCCTTAATTCTCGAGAATTAAGGCCGTAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-379s21c1
Sequence:CCGGAGAAGCTCGTGCGAGTGATAGCTCGAGCTATCACTCGCACGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-859s21c1
Sequence:CCGGTCCAGCTCCCAGTGGATATTGCTCGAGCAATATCCACTGGGAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152268.2-2135s21c1
Sequence:CCGGAGATCTGTAACGTCCTTATAGCTCGAGCTATAAGGACGTTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-966s21c1
Sequence:CCGGTGCCAGGGCCCATTGACTAAACTCGAGTTTAGTCAATGGGCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-560s21c1
Sequence:CCGGGGAAGCCATTACGGCCTTAATCTCGAGATTAAGGCCGTAATGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152268
PARS2 MISSION shRNA shRNA Plasmid DNA
prolyl-tRNA synthetase 2, mitochondrial (putative)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-1465s1c1
Sequence:CCGGCCAAAGATGGAGTCATGGATTCTCGAGAATCCATGACTCCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-930s1c1
Sequence:CCGGGAGACACTAGACTTGTCACAACTCGAGTTGTGACAAGTCTAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-1060s1c1
Sequence:CCGGCCAATGTCTGTGGCAAACCAACTCGAGTTGGTTTGCCACAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-480s1c1
Sequence:CCGGCGGTGGGACTTGATGGGCAAACTCGAGTTTGCCCATCAAGTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-561s1c1
Sequence:CCGGGAAGCCATTACGGCCTTAATTCTCGAGAATTAAGGCCGTAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-379s21c1
Sequence:CCGGAGAAGCTCGTGCGAGTGATAGCTCGAGCTATCACTCGCACGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-859s21c1
Sequence:CCGGTCCAGCTCCCAGTGGATATTGCTCGAGCAATATCCACTGGGAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152268.2-2135s21c1
Sequence:CCGGAGATCTGTAACGTCCTTATAGCTCGAGCTATAAGGACGTTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-966s21c1
Sequence:CCGGTGCCAGGGCCCATTGACTAAACTCGAGTTTAGTCAATGGGCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-560s21c1
Sequence:CCGGGGAAGCCATTACGGCCTTAATCTCGAGATTAAGGCCGTAATGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152268
PARS2 MISSION shRNA Lentiviral Transduction Particles
prolyl-tRNA synthetase 2, mitochondrial (putative)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-1465s1c1
Sequence:CCGGCCAAAGATGGAGTCATGGATTCTCGAGAATCCATGACTCCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-930s1c1
Sequence:CCGGGAGACACTAGACTTGTCACAACTCGAGTTGTGACAAGTCTAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-1060s1c1
Sequence:CCGGCCAATGTCTGTGGCAAACCAACTCGAGTTGGTTTGCCACAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-480s1c1
Sequence:CCGGCGGTGGGACTTGATGGGCAAACTCGAGTTTGCCCATCAAGTCCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152268.2-561s1c1
Sequence:CCGGGAAGCCATTACGGCCTTAATTCTCGAGAATTAAGGCCGTAATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-379s21c1
Sequence:CCGGAGAAGCTCGTGCGAGTGATAGCTCGAGCTATCACTCGCACGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-859s21c1
Sequence:CCGGTCCAGCTCCCAGTGGATATTGCTCGAGCAATATCCACTGGGAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152268.2-2135s21c1
Sequence:CCGGAGATCTGTAACGTCCTTATAGCTCGAGCTATAAGGACGTTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-966s21c1
Sequence:CCGGTGCCAGGGCCCATTGACTAAACTCGAGTTTAGTCAATGGGCCCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152268.2-560s21c1
Sequence:CCGGGGAAGCCATTACGGCCTTAATCTCGAGATTAAGGCCGTAATGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks