EMAIL THIS PAGE TO A FRIEND

PARVG

parvin, gamma

UniProtKB ID: Q9HBI0, B4DDW5, E7EVM6, Q9BQX5, Q9NSG1
Gene ID:
Human(64098) Summary: Members of the parvin family, including PARVG, are actin-binding proteins associated with focal contacts.[supplied by OMIM, Aug 2004]
Mouse(64099) parvin, gamma
Rat(689069) parvin, gamma
Zebrafish(100037387) parvin, gamma
cow(790892) parvin, gamma
dog(481214) parvin, gamma
domestic cat(101088092) parvin, gamma
chicken(418236) parvin, gamma
Gene Class: Cytoskeleton
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022321 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022321 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022321 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022141 Rosetta Predictions human pricing
NM_001130583 Rosetta Predictions rat pricing
NM_022321 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162050 predicted 682
2 SASI_Hs01_00162051 predicted 978
3 SASI_Hs02_00355553 predicted 1268
4 SASI_Hs01_00162052 predicted 546
5 SASI_Hs01_00162053 predicted 973
6 SASI_Hs01_00162054 predicted 728
7 SASI_Hs01_00162055 predicted 1303
8 SASI_Hs01_00162056 predicted 1185
9 SASI_Hs02_00355554 predicted 1022
10 SASI_Hs01_00162057 predicted 1043
11 SASI_Hs01_00162049 predicted 1260
12 SASI_Hs01_00162058 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255999 predicted 1423
2 SASI_Rn02_00256000 predicted 937
3 SASI_Rn02_00256001 predicted 1404
4 SASI_Rn02_00256002 predicted 1058
5 SASI_Rn02_00256003 predicted 1000
6 SASI_Rn02_00256004 predicted 780
7 SASI_Rn02_00256005 predicted 1377
8 SASI_Rn02_00256006 predicted 1046
9 SASI_Rn02_00256007 predicted 749
10 SASI_Rn02_00256008 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030797 predicted 336
2 SASI_Mm01_00030798 predicted 367
3 SASI_Mm01_00030799 predicted 689
4 SASI_Mm01_00030800 predicted 1320
5 SASI_Mm01_00030801 predicted 591
6 SASI_Mm01_00030802 predicted 1395
7 SASI_Mm02_00326554 predicted 929
8 SASI_Mm02_00326555 predicted 1295
9 SASI_Mm01_00030803 predicted 700
10 SASI_Mm01_00030804 predicted 351
11 SASI_Mm01_00030805 predicted 1227
12 SASI_Mm01_00030806 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022141
PARVG MISSION shRNA Bacterial Glycerol Stock
parvin, gamma
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022141.4-1462s1c1
Sequence:CCGGCCTCCCACAGTCCCGCTGTTTCTCGAGAAACAGCGGGACTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-622s1c1
Sequence:CCGGGCTCATCCTACACCACCTATTCTCGAGAATAGGTGGTGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-1151s1c1
Sequence:CCGGGAAGGCTTCTTCCTGCACTTACTCGAGTAAGTGCAGGAAGAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-946s1c1
Sequence:CCGGCACTGAATACAGCACAGACAACTCGAGTTGTCTGTGCTGTATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-1121s1c1
Sequence:CCGGGTCATCTTACTCTTGCTGATTCTCGAGAATCAGCAAGAGTAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000455003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022141.5-1179s21c1
Sequence:CCGGAGAATCTGGACACCCAGTTTGCTCGAGCAAACTGGGTGTCCAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022141.5-1069s21c1
Sequence:CCGGGGACGTCTTTGATGAATTATTCTCGAGAATAATTCATCAAAGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022141
PARVG MISSION shRNA shRNA Plasmid DNA
parvin, gamma
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022141.4-1462s1c1
Sequence:CCGGCCTCCCACAGTCCCGCTGTTTCTCGAGAAACAGCGGGACTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-622s1c1
Sequence:CCGGGCTCATCCTACACCACCTATTCTCGAGAATAGGTGGTGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-1151s1c1
Sequence:CCGGGAAGGCTTCTTCCTGCACTTACTCGAGTAAGTGCAGGAAGAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-946s1c1
Sequence:CCGGCACTGAATACAGCACAGACAACTCGAGTTGTCTGTGCTGTATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-1121s1c1
Sequence:CCGGGTCATCTTACTCTTGCTGATTCTCGAGAATCAGCAAGAGTAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000455003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022141.5-1179s21c1
Sequence:CCGGAGAATCTGGACACCCAGTTTGCTCGAGCAAACTGGGTGTCCAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022141.5-1069s21c1
Sequence:CCGGGGACGTCTTTGATGAATTATTCTCGAGAATAATTCATCAAAGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022141
PARVG MISSION shRNA Lentiviral Transduction Particles
parvin, gamma
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022141.4-1462s1c1
Sequence:CCGGCCTCCCACAGTCCCGCTGTTTCTCGAGAAACAGCGGGACTGTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-622s1c1
Sequence:CCGGGCTCATCCTACACCACCTATTCTCGAGAATAGGTGGTGTAGGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-1151s1c1
Sequence:CCGGGAAGGCTTCTTCCTGCACTTACTCGAGTAAGTGCAGGAAGAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-946s1c1
Sequence:CCGGCACTGAATACAGCACAGACAACTCGAGTTGTCTGTGCTGTATTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022141.4-1121s1c1
Sequence:CCGGGTCATCTTACTCTTGCTGATTCTCGAGAATCAGCAAGAGTAAGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000455003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022141.5-1179s21c1
Sequence:CCGGAGAATCTGGACACCCAGTTTGCTCGAGCAAACTGGGTGTCCAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022141.5-1069s21c1
Sequence:CCGGGGACGTCTTTGATGAATTATTCTCGAGAATAATTCATCAAAGACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022321
PARVG MISSION shRNA Bacterial Glycerol Stock
parvin, gamma
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022321.2-1440s1c1
Sequence:CCGGCCAGTCTGTCTACTAAGGCTACTCGAGTAGCCTTAGTAGACAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022321.2-2196s1c1
Sequence:CCGGGCAGGCCACTCATAAGTGTTACTCGAGTAACACTTATGAGTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022321.2-1000s1c1
Sequence:CCGGCCCTGTCAACCCTGAAGATATCTCGAGATATCTTCAGGGTTGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022321.2-1039s1c1
Sequence:CCGGGAGCACACTGAGGATACTTTACTCGAGTAAAGTATCCTCAGTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022321
PARVG MISSION shRNA shRNA Plasmid DNA
parvin, gamma
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022321.2-1440s1c1
Sequence:CCGGCCAGTCTGTCTACTAAGGCTACTCGAGTAGCCTTAGTAGACAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022321.2-2196s1c1
Sequence:CCGGGCAGGCCACTCATAAGTGTTACTCGAGTAACACTTATGAGTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022321.2-1000s1c1
Sequence:CCGGCCCTGTCAACCCTGAAGATATCTCGAGATATCTTCAGGGTTGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022321.2-1039s1c1
Sequence:CCGGGAGCACACTGAGGATACTTTACTCGAGTAAAGTATCCTCAGTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022321
PARVG MISSION shRNA Lentiviral Transduction Particles
parvin, gamma
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022321.2-1440s1c1
Sequence:CCGGCCAGTCTGTCTACTAAGGCTACTCGAGTAGCCTTAGTAGACAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022321.2-2196s1c1
Sequence:CCGGGCAGGCCACTCATAAGTGTTACTCGAGTAACACTTATGAGTGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022321.2-1000s1c1
Sequence:CCGGCCCTGTCAACCCTGAAGATATCTCGAGATATCTTCAGGGTTGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022321.2-1039s1c1
Sequence:CCGGGAGCACACTGAGGATACTTTACTCGAGTAAAGTATCCTCAGTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks