EMAIL THIS PAGE TO A FRIEND

PAX3

paired box 3

Synonyms: CDHS HUP2 WS1 WS3
Gene ID:
Human(5077) Summary: This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
Mouse(18505) paired box gene 3
Rat(114502) paired box 3
chicken(374127) paired box 3
dog(488544) paired box 3
cow(540951) paired box 3
Horse(100056517) paired box 3
sheep(101119698) paired box 3
282 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32736 Anti-PAX3 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, canine, horse, zebrafish, rabbit, rat,
western blot pricing
AV32445 Anti-PAX3 (AB2) antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, canine, chicken, human, rat
western blot pricing
SAB2500753 Anti-PAX3 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry pricing
SAB2502032 Anti-PAX3 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, pig, rat, canine, human, bovine
ELISA, western blot pricing
SAB2107888 Anti-PAX3 antibody produced in rabbit affinity isolated antibody human, bovine, horse, guinea pig, canine, rat, rabbit, yeast, pig, mouse
western blot pricing
SAB2107889 Anti-PAX3 antibody produced in rabbit IgG fraction of antiserum goat, canine, rat, horse, guinea pig, human, bovine, mouse, rabbit
western blot pricing
AV32446 Anti-PAX3 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, human, chicken, bovine, rat, mouse
western blot pricing
HPA063659 Anti-PAX3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA069000 Anti-PAX3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0005077M5 Monoclonal Anti-PAX3 antibody produced in mouse clone 4F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404167 Monoclonal Anti-PAX3 antibody produced in mouse clone 3A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000438 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132501 MISSION® esiRNA esiRNA human PAX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000438 Rosetta Predictions human pricing
NM_001127366 Rosetta Predictions human pricing
NM_013942 Rosetta Predictions human pricing
NM_181457 Rosetta Predictions human pricing
NM_181458 Rosetta Predictions human pricing
NM_181459 Rosetta Predictions human pricing
NM_181460 Rosetta Predictions human pricing
NM_181461 Rosetta Predictions human pricing
XM_001063110 Rosetta Predictions rat pricing
XM_001063223 Rosetta Predictions rat pricing
XM_343601 Rosetta Predictions rat pricing
NM_008781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174290 predicted 372
2 SASI_Hs01_00174291 predicted 432
3 SASI_Hs02_00302549 predicted 424
4 SASI_Hs01_00174296 predicted 464
5 SASI_Hs01_00174294 predicted 419
6 SASI_Hs02_00302550 predicted 458
7 SASI_Hs02_00302551 predicted 430
8 SASI_Hs02_00302552 predicted 378
9 SASI_Hs01_00174298 predicted 454
10 SASI_Hs02_00302553 predicted 424
11 SASI_Hs01_00174289 predicted 635
12 SASI_Hs01_00174292 predicted 737
13 SASI_Hs01_00174293 predicted 697
14 SASI_Hs01_00174295 predicted 671
15 SASI_Hs01_00174297 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329254 predicted 376
2 SASI_Hs02_00329255 predicted 428
3 SASI_Hs02_00329256 predicted 427
4 SASI_Hs02_00329257 predicted 464
5 SASI_Hs02_00329258 predicted 423
6 SASI_Hs02_00329259 predicted 462
7 SASI_Hs02_00329260 predicted 427
8 SASI_Hs02_00329261 predicted 382
9 SASI_Hs02_00329262 predicted 454
10 SASI_Hs02_00329263 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024870 predicted 373
2 SASI_Hs01_00024871 predicted 434
3 SASI_Hs02_00344880 predicted 428
4 SASI_Hs01_00024876 predicted 466
5 SASI_Hs01_00024874 predicted 422
6 SASI_Hs02_00344881 predicted 455
7 SASI_Hs02_00344882 predicted 429
8 SASI_Hs02_00344883 predicted 374
9 SASI_Hs01_00024878 predicted 455
10 SASI_Hs02_00344884 predicted 423
11 SASI_Hs01_00024869 predicted 639
12 SASI_Hs01_00024872 predicted 739
13 SASI_Hs01_00024873 predicted 700
14 SASI_Hs01_00024875 predicted 675
15 SASI_Hs01_00024877 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094210 predicted 378
2 SASI_Hs01_00094211 predicted 434
3 SASI_Hs02_00370064 predicted 433
4 SASI_Hs01_00094216 predicted 458
5 SASI_Hs01_00094214 predicted 426
6 SASI_Hs02_00370065 predicted 460
7 SASI_Hs02_00370066 predicted 436
8 SASI_Hs02_00370067 predicted 374
9 SASI_Hs01_00094218 predicted 462
10 SASI_Hs02_00370068 predicted 424
11 SASI_Hs01_00094209 predicted 645
12 SASI_Hs01_00094212 predicted 738
13 SASI_Hs01_00094213 predicted 690
14 SASI_Hs01_00094215 predicted 677
15 SASI_Hs01_00094217 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206783 predicted 375
2 SASI_Hs01_00206784 predicted 431
3 SASI_Hs02_00370069 predicted 426
4 SASI_Hs01_00206789 predicted 464
5 SASI_Hs01_00206787 predicted 423
6 SASI_Hs02_00370070 predicted 463
7 SASI_Hs02_00370071 predicted 434
8 SASI_Hs02_00370072 predicted 378
9 SASI_Hs01_00206791 predicted 457
10 SASI_Hs02_00370073 predicted 421
11 SASI_Hs01_00206782 predicted 642
12 SASI_Hs01_00206785 predicted 736
13 SASI_Hs01_00206786 predicted 700
14 SASI_Hs01_00206788 predicted 675
15 SASI_Hs01_00206790 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153054 predicted 376
2 SASI_Hs01_00153055 predicted 427
3 SASI_Hs02_00370074 predicted 426
4 SASI_Hs01_00153060 predicted 461
5 SASI_Hs01_00153058 predicted 422
6 SASI_Hs02_00370075 predicted 464
7 SASI_Hs02_00370076 predicted 436
8 SASI_Hs02_00370077 predicted 378
9 SASI_Hs01_00153062 predicted 460
10 SASI_Hs02_00370078 predicted 424
11 SASI_Hs01_00153053 predicted 636
12 SASI_Hs01_00153056 predicted 729
13 SASI_Hs01_00153057 predicted 690
14 SASI_Hs01_00153059 predicted 677
15 SASI_Hs01_00153061 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239214 predicted 376
2 SASI_Hs01_00239215 predicted 435
3 SASI_Hs02_00370079 predicted 427
4 SASI_Hs01_00239220 predicted 458
5 SASI_Hs01_00239218 predicted 418
6 SASI_Hs02_00370080 predicted 463
7 SASI_Hs02_00370081 predicted 435
8 SASI_Hs02_00370082 predicted 380
9 SASI_Hs01_00239222 predicted 456
10 SASI_Hs02_00370083 predicted 428
11 SASI_Hs01_00239213 predicted 636
12 SASI_Hs01_00239216 predicted 737
13 SASI_Hs01_00239217 predicted 691
14 SASI_Hs01_00239219 predicted 675
15 SASI_Hs01_00239221 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029920 predicted 380
2 SASI_Hs01_00029921 predicted 428
3 SASI_Hs02_00370084 predicted 429
4 SASI_Hs01_00029926 predicted 464
5 SASI_Hs01_00029924 predicted 426
6 SASI_Hs02_00370085 predicted 460
7 SASI_Hs02_00370086 predicted 431
8 SASI_Hs02_00370087 predicted 379
9 SASI_Hs01_00029928 predicted 461
10 SASI_Hs02_00370088 predicted 428
11 SASI_Hs01_00029919 predicted 639
12 SASI_Hs01_00029922 predicted 738
13 SASI_Hs01_00029923 predicted 690
14 SASI_Hs01_00029925 predicted 678
15 SASI_Hs01_00029927 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305826 predicted 1763
2 SASI_Rn02_00305827 predicted 1729
3 SASI_Rn02_00305828 predicted 1832
4 SASI_Rn02_00305829 predicted 953
5 SASI_Rn02_00305830 predicted 1791
6 SASI_Rn02_00305831 predicted 1311
7 SASI_Rn02_00305832 predicted 1399
8 SASI_Rn02_00305833 predicted 1344
9 SASI_Rn02_00305834 predicted 1543
10 SASI_Rn02_00305835 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306297 predicted 496
2 SASI_Rn02_00306298 predicted 1343
3 SASI_Rn02_00306299 predicted 1340
4 SASI_Rn02_00306300 predicted 1310
5 SASI_Rn02_00306301 predicted 1407
6 SASI_Rn02_00306302 predicted 1545
7 SASI_Rn02_00306303 predicted 992
8 SASI_Rn02_00306304 predicted 1142
9 SASI_Rn02_00306305 predicted 1321
10 SASI_Rn02_00306306 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396098 predicted 1729
2 SASI_Rn02_00396099 predicted 493
3 SASI_Rn02_00396100 predicted 958
4 SASI_Rn02_00396101 predicted 967
5 SASI_Rn02_00396102 predicted 1305
6 SASI_Rn02_00396103 predicted 1391
7 SASI_Rn02_00396104 predicted 1338
8 SASI_Rn02_00396105 predicted 1541
9 SASI_Rn02_00396106 predicted 996
10 SASI_Rn02_00396107 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193740 predicted 1782
2 SASI_Mm02_00314679 predicted 541
3 SASI_Mm01_00193741 predicted 746
4 SASI_Mm01_00193742 predicted 1798
5 SASI_Mm01_00193743 predicted 1404
6 SASI_Mm01_00193744 predicted 1740
7 SASI_Mm01_00193745 predicted 1311
8 SASI_Mm01_00193747 predicted 1848
9 SASI_Mm01_00193748 predicted 1715
10 SASI_Mm01_00193749 predicted 983
11 SASI_Mm01_00193746 predicted 1925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008781
VALIDATED
PAX3 MISSION shRNA Bacterial Glycerol Stock
paired box 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008781.2-2201s1c1
Sequence:CCGGCCGTGGTATTAAATATGACATCTCGAGATGTCATATTTAATACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-777s1c1
Sequence:CCGGGCTGGGAAATCAGAGACAAATCTCGAGATTTGTCTCTGATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-776s1c1
Sequence:CCGGAGCTGGGAAATCAGAGACAAACTCGAGTTTGTCTCTGATTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-1199s1c1
Sequence:CCGGCGTGCAAGATGGAGGAAACAACTCGAGTTGTTTCCTCCATCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008781.2-853s1c1
Sequence:CCGGCCGCATCCTGAGGAGTAAATTCTCGAGAATTTACTCCTCAGGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-776s21c1
Sequence:CCGGGCTGGGAAATCAGAGACAAATCTCGAGATTTGTCTCTGATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-851s21c1
Sequence:CCGGGCCGCATCCTGAGGAGTAAATCTCGAGATTTACTCCTCAGGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-584s21c1
Sequence:CCGGGCATTCGGCCTTGCGTCATTTCTCGAGAAATGACGCAAGGCCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-1318s21c1
Sequence:CCGGTCTTACCAGCCCACGTCTATTCTCGAGAATAGACGTGGGCTGGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008781.4-2191s21c1
Sequence:CCGGCCTTTGATACCGTGGTATTAACTCGAGTTAATACCACGGTATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008781
VALIDATED
PAX3 MISSION shRNA shRNA Plasmid DNA
paired box 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008781.2-2201s1c1
Sequence:CCGGCCGTGGTATTAAATATGACATCTCGAGATGTCATATTTAATACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-777s1c1
Sequence:CCGGGCTGGGAAATCAGAGACAAATCTCGAGATTTGTCTCTGATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-776s1c1
Sequence:CCGGAGCTGGGAAATCAGAGACAAACTCGAGTTTGTCTCTGATTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-1199s1c1
Sequence:CCGGCGTGCAAGATGGAGGAAACAACTCGAGTTGTTTCCTCCATCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008781.2-853s1c1
Sequence:CCGGCCGCATCCTGAGGAGTAAATTCTCGAGAATTTACTCCTCAGGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-776s21c1
Sequence:CCGGGCTGGGAAATCAGAGACAAATCTCGAGATTTGTCTCTGATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-851s21c1
Sequence:CCGGGCCGCATCCTGAGGAGTAAATCTCGAGATTTACTCCTCAGGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-584s21c1
Sequence:CCGGGCATTCGGCCTTGCGTCATTTCTCGAGAAATGACGCAAGGCCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-1318s21c1
Sequence:CCGGTCTTACCAGCCCACGTCTATTCTCGAGAATAGACGTGGGCTGGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008781.4-2191s21c1
Sequence:CCGGCCTTTGATACCGTGGTATTAACTCGAGTTAATACCACGGTATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008781
VALIDATED
PAX3 MISSION shRNA Lentiviral Transduction Particles
paired box 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008781.2-2201s1c1
Sequence:CCGGCCGTGGTATTAAATATGACATCTCGAGATGTCATATTTAATACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-777s1c1
Sequence:CCGGGCTGGGAAATCAGAGACAAATCTCGAGATTTGTCTCTGATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-776s1c1
Sequence:CCGGAGCTGGGAAATCAGAGACAAACTCGAGTTTGTCTCTGATTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008781.2-1199s1c1
Sequence:CCGGCGTGCAAGATGGAGGAAACAACTCGAGTTGTTTCCTCCATCTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008781.2-853s1c1
Sequence:CCGGCCGCATCCTGAGGAGTAAATTCTCGAGAATTTACTCCTCAGGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-776s21c1
Sequence:CCGGGCTGGGAAATCAGAGACAAATCTCGAGATTTGTCTCTGATTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-851s21c1
Sequence:CCGGGCCGCATCCTGAGGAGTAAATCTCGAGATTTACTCCTCAGGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-584s21c1
Sequence:CCGGGCATTCGGCCTTGCGTCATTTCTCGAGAAATGACGCAAGGCCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008781.4-1318s21c1
Sequence:CCGGTCTTACCAGCCCACGTCTATTCTCGAGAATAGACGTGGGCTGGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008781.4-2191s21c1
Sequence:CCGGCCTTTGATACCGTGGTATTAACTCGAGTTAATACCACGGTATCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000438
VALIDATED
PAX3 MISSION shRNA Bacterial Glycerol Stock
paired box 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000438.3-1248s1c1
Sequence:CCGGGCTCTCACTCTGTTGCCATTACTCGAGTAATGGCAACAGAGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-755s1c1
Sequence:CCGGGCTGGGAAATCCGAGACAAATCTCGAGATTTGTCTCGGATTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-837s1c1
Sequence:CCGGCCTGAGAAGTAAATTCGGGAACTCGAGTTCCCGAATTTACTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-531s1c1
Sequence:CCGGCCGCCACAAGATCGTGGAGATCTCGAGATCTCCACGATCTTGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000438.3-901s1c1
Sequence:CCGGGAAAGCGAGAAGAAGGCCAAACTCGAGTTTGGCCTTCTTCTCGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000438.4-1111s21c1
Sequence:CCGGAGAGGGACACTAGGAATCAAACTCGAGTTTGATTCCTAGTGTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000438.4-1087s21c1
Sequence:CCGGGTAACGACATGGAACTGAAAGCTCGAGCTTTCAGTTCCATGTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000438.4-1006s21c1
Sequence:CCGGGCTAGCTGACATTGGTGATCTCTCGAGAGATCACCAATGTCAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000438
VALIDATED
PAX3 MISSION shRNA shRNA Plasmid DNA
paired box 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000438.3-1248s1c1
Sequence:CCGGGCTCTCACTCTGTTGCCATTACTCGAGTAATGGCAACAGAGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-755s1c1
Sequence:CCGGGCTGGGAAATCCGAGACAAATCTCGAGATTTGTCTCGGATTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-837s1c1
Sequence:CCGGCCTGAGAAGTAAATTCGGGAACTCGAGTTCCCGAATTTACTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-531s1c1
Sequence:CCGGCCGCCACAAGATCGTGGAGATCTCGAGATCTCCACGATCTTGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000438.3-901s1c1
Sequence:CCGGGAAAGCGAGAAGAAGGCCAAACTCGAGTTTGGCCTTCTTCTCGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000438.4-1111s21c1
Sequence:CCGGAGAGGGACACTAGGAATCAAACTCGAGTTTGATTCCTAGTGTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000438.4-1087s21c1
Sequence:CCGGGTAACGACATGGAACTGAAAGCTCGAGCTTTCAGTTCCATGTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000438.4-1006s21c1
Sequence:CCGGGCTAGCTGACATTGGTGATCTCTCGAGAGATCACCAATGTCAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000438
VALIDATED
PAX3 MISSION shRNA Lentiviral Transduction Particles
paired box 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000438.3-1248s1c1
Sequence:CCGGGCTCTCACTCTGTTGCCATTACTCGAGTAATGGCAACAGAGTGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-755s1c1
Sequence:CCGGGCTGGGAAATCCGAGACAAATCTCGAGATTTGTCTCGGATTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-837s1c1
Sequence:CCGGCCTGAGAAGTAAATTCGGGAACTCGAGTTCCCGAATTTACTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000438.3-531s1c1
Sequence:CCGGCCGCCACAAGATCGTGGAGATCTCGAGATCTCCACGATCTTGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000438.3-901s1c1
Sequence:CCGGGAAAGCGAGAAGAAGGCCAAACTCGAGTTTGGCCTTCTTCTCGCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000438.4-1111s21c1
Sequence:CCGGAGAGGGACACTAGGAATCAAACTCGAGTTTGATTCCTAGTGTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000438.4-1087s21c1
Sequence:CCGGGTAACGACATGGAACTGAAAGCTCGAGCTTTCAGTTCCATGTCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000438.4-1006s21c1
Sequence:CCGGGCTAGCTGACATTGGTGATCTCTCGAGAGATCACCAATGTCAGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks